Mutagenetix > Incidental Mutation

Incidental Mutation 'R1954:Tenm2'

217582

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

039968-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R1954 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36047547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1433 (N1433I)

Ref Sequence

ENSEMBL: ENSMUSP00000129951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057207
AA Change: N1434I

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: N1434I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102801
AA Change: N1433I

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: N1433I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163524
AA Change: N1433I

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: N1433I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Meta Mutation Damage Score

0.7107

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,566,753		probably benign	Het
Adamts15	T	A	9: 30,910,708	M478L	probably benign	Het
Akap8l	T	A	17: 32,336,736	Y123F	possibly damaging	Het
Anapc4	T	G	5: 52,846,625		probably benign	Het
Arap3	A	G	18: 37,982,002	V987A	probably damaging	Het
Atp2b4	T	A	1: 133,739,992	T105S	probably damaging	Het
Atp6v0d1	A	G	8: 105,565,893	L7P	probably damaging	Het
Atp6v1b2	T	C	8: 69,105,903	V341A	possibly damaging	Het
Baz2b	C	A	2: 59,968,743	A346S	probably benign	Het
Brpf3	G	A	17: 28,806,559	S202N	probably benign	Het
Btnl4	T	C	17: 34,472,930	K233E	possibly damaging	Het
Capn7	A	G	14: 31,360,150	T438A	probably damaging	Het
Cars2	A	T	8: 11,550,286	Y68N	probably damaging	Het
Cbx2	G	T	11: 119,028,340	G244W	probably damaging	Het
Ccr4	A	T	9: 114,492,685	V104D	probably damaging	Het
Cdc5l	T	C	17: 45,426,516		probably null	Het
Cep170	A	T	1: 176,756,384	C810S	probably benign	Het
Clp1	T	C	2: 84,724,051	D258G	probably damaging	Het
Clstn3	T	C	6: 124,459,298	E164G	possibly damaging	Het
Col28a1	T	C	6: 7,998,516	E1131G	probably damaging	Het
Cps1	A	G	1: 67,195,196	D914G	possibly damaging	Het
Ctnnal1	C	T	4: 56,817,242		probably benign	Het
Cyp2c38	A	G	19: 39,404,687	L312P	probably damaging	Het
Cytip	T	C	2: 58,148,253	N99D	possibly damaging	Het
Dennd4a	A	T	9: 64,852,467	T285S	probably benign	Het
Dhx8	A	G	11: 101,753,279	S842G	probably damaging	Het
Disp1	A	T	1: 183,088,543	M771K	probably damaging	Het
Dnah17	A	G	11: 118,024,731	I4326T	probably damaging	Het
Efcab7	T	C	4: 99,900,690	F345L	probably damaging	Het
Erc1	G	T	6: 119,797,305	Q230K	probably damaging	Het
Ern1	A	T	11: 106,421,974		probably benign	Het
Espl1	T	C	15: 102,298,388	Y96H	probably damaging	Het
Fam135a	A	T	1: 24,029,602	L533I	probably damaging	Het
Fat2	G	A	11: 55,311,084	T388I	probably benign	Het
Galnt1	T	G	18: 24,271,774		probably benign	Het
Glmn	A	G	5: 107,572,377	F212S	probably damaging	Het
Gm3604	A	T	13: 62,369,211	N444K	probably damaging	Het
Gm5434	A	G	12: 36,090,596		probably benign	Het
Gm8989	A	C	7: 106,329,681	D336E	probably damaging	Het
H2-M10.3	T	C	17: 36,367,498	D145G	probably damaging	Het
Hic2	T	A	16: 17,258,993	L562Q	probably damaging	Het
Hip1r	G	T	5: 124,001,844	E1003D	probably damaging	Het
Hist1h1c	T	C	13: 23,739,402	V185A	unknown	Het
Hist1h1d	A	G	13: 23,555,516		probably benign	Het
Hsfy2	C	T	1: 56,637,183	C65Y	probably benign	Het
Inpp1	T	C	1: 52,794,629	T103A	probably damaging	Het
Ints5	T	C	19: 8,894,896	V73A	probably damaging	Het
Iqch	A	T	9: 63,548,016	D166E	probably benign	Het
Klhdc3	A	T	17: 46,677,975	N96K	probably damaging	Het
Klk1b8	C	T	7: 43,953,848		probably benign	Het
Klrb1	T	C	6: 128,723,073		probably null	Het
Krt71	C	A	15: 101,735,466	G446*	probably null	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lemd3	G	T	10: 120,978,940	S129R	probably damaging	Het
Lrp1b	A	G	2: 40,858,441	L3015P	probably damaging	Het
Mdga2	T	C	12: 66,486,708		probably benign	Het
Mlst8	A	T	17: 24,477,221	I178N	probably damaging	Het
Mon2	A	T	10: 123,038,483	I320N	probably damaging	Het
Morc2b	T	C	17: 33,137,490	Y436C	probably damaging	Het
Moxd1	T	A	10: 24,279,883	M295K	probably benign	Het
Mrps5	T	A	2: 127,596,897		probably null	Het
Mtor	C	A	4: 148,468,273	S744R	probably damaging	Het
Myo3a	T	A	2: 22,241,226	D61E	probably damaging	Het
Nars	C	T	18: 64,500,564	R545Q	probably damaging	Het
Ncoa6	A	G	2: 155,406,821	V1521A	possibly damaging	Het
Ndor1	T	C	2: 25,255,293	E20G	possibly damaging	Het
Nipsnap3b	T	C	4: 53,017,213		probably benign	Het
Notch3	G	T	17: 32,166,678	A39E	probably benign	Het
Olfr1336	G	T	7: 6,461,145	W212L	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,977	I224T	possibly damaging	Het
Olfr345	A	G	2: 36,640,215	M59V	possibly damaging	Het
Otud3	T	C	4: 138,898,032	K237R	possibly damaging	Het
Papola	T	A	12: 105,828,273		probably null	Het
Parl	T	A	16: 20,302,327	M1L	possibly damaging	Het
Parp14	G	T	16: 35,858,301	N432K	probably benign	Het
Patz1	T	G	11: 3,291,088	S159A	probably damaging	Het
Prpf6	T	G	2: 181,632,077	M338R	probably benign	Het
Psd3	A	G	8: 67,697,075	L343P	probably damaging	Het
Ptpn23	A	T	9: 110,386,325	N1422K	probably damaging	Het
Rab19	A	T	6: 39,384,082	T55S	probably benign	Het
Sh3yl1	A	G	12: 30,922,333	K34E	possibly damaging	Het
Skint8	T	A	4: 111,950,081	F321L	possibly damaging	Het
Slc25a46	A	T	18: 31,600,241		probably null	Het
Slc26a3	T	C	12: 31,450,816	L184S	probably damaging	Het
Slc39a10	A	T	1: 46,835,174	S323T	possibly damaging	Het
Sorbs2	G	T	8: 45,745,738	R20L	probably benign	Het
Stk32a	A	T	18: 43,212,025	D13V	probably benign	Het
Tab2	T	C	10: 7,919,330	T463A	probably damaging	Het
Tmem200c	A	T	17: 68,840,961	I180F	probably damaging	Het
Tmem232	G	T	17: 65,484,487	H129N	probably benign	Het
Tmem242	T	C	17: 5,439,579	T47A	possibly damaging	Het
Ube2d1	A	T	10: 71,285,123	M1K	probably null	Het
Uckl1	T	C	2: 181,570,527	Q332R	probably benign	Het
Unc5b	T	C	10: 60,769,265		probably benign	Het
Vmn2r114	T	C	17: 23,311,112	Y107C	probably benign	Het
Vmn2r82	A	T	10: 79,396,056	S630C	probably damaging	Het
Wdr25	T	A	12: 108,898,541	V204E	probably damaging	Het
Xab2	T	A	8: 3,616,094	D227V	probably damaging	Het
Zfp286	A	G	11: 62,783,708	S104P	possibly damaging	Het
Zfp345	T	C	2: 150,474,821	D22G	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTTGCAGTCACAGTCTGAGGC -3'
(R):5'- AAGCTAAGTCATTTTCTCCTAGACG -3'

Sequencing Primer
(F):5'- CTAAGAGGCAGATCTCTCCATTGG -3'
(R):5'- CGAATAAAATTAACATGTTCGAGGC -3'

Posted On

2014-08-01