Incidental Mutation 'R1954:Mdga2'
ID 217594
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 039968-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1954 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 66533482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably benign
Transcript: ENSMUST00000037181
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178724
Predicted Effect probably benign
Transcript: ENSMUST00000178814
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222167
Predicted Effect probably benign
Transcript: ENSMUST00000222623
Predicted Effect probably benign
Transcript: ENSMUST00000222987
Predicted Effect probably benign
Transcript: ENSMUST00000223141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222736
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,822,004 (GRCm39) M478L probably benign Het
Akap8l T A 17: 32,555,710 (GRCm39) Y123F possibly damaging Het
Anapc4 T G 5: 53,003,967 (GRCm39) probably benign Het
Arap3 A G 18: 38,115,055 (GRCm39) V987A probably damaging Het
Atp2b4 T A 1: 133,667,730 (GRCm39) T105S probably damaging Het
Atp6v0d1 A G 8: 106,292,525 (GRCm39) L7P probably damaging Het
Atp6v1b2 T C 8: 69,558,555 (GRCm39) V341A possibly damaging Het
Baz2b C A 2: 59,799,087 (GRCm39) A346S probably benign Het
Brpf3 G A 17: 29,025,533 (GRCm39) S202N probably benign Het
Btnl4 T C 17: 34,691,904 (GRCm39) K233E possibly damaging Het
Capn7 A G 14: 31,082,107 (GRCm39) T438A probably damaging Het
Cars2 A T 8: 11,600,286 (GRCm39) Y68N probably damaging Het
Cbx2 G T 11: 118,919,166 (GRCm39) G244W probably damaging Het
Ccr4 A T 9: 114,321,753 (GRCm39) V104D probably damaging Het
Cdc5l T C 17: 45,737,442 (GRCm39) probably null Het
Cep170 A T 1: 176,583,950 (GRCm39) C810S probably benign Het
Cfap299 A T 5: 98,714,612 (GRCm39) probably benign Het
Clp1 T C 2: 84,554,395 (GRCm39) D258G probably damaging Het
Clstn3 T C 6: 124,436,257 (GRCm39) E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 (GRCm39) E1131G probably damaging Het
Cps1 A G 1: 67,234,355 (GRCm39) D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 (GRCm39) probably benign Het
Cyp2c38 A G 19: 39,393,131 (GRCm39) L312P probably damaging Het
Cytip T C 2: 58,038,265 (GRCm39) N99D possibly damaging Het
Dennd4a A T 9: 64,759,749 (GRCm39) T285S probably benign Het
Dhx8 A G 11: 101,644,105 (GRCm39) S842G probably damaging Het
Disp1 A T 1: 182,870,107 (GRCm39) M771K probably damaging Het
Dnah17 A G 11: 117,915,557 (GRCm39) I4326T probably damaging Het
Efcab7 T C 4: 99,757,887 (GRCm39) F345L probably damaging Het
Erc1 G T 6: 119,774,266 (GRCm39) Q230K probably damaging Het
Ern1 A T 11: 106,312,800 (GRCm39) probably benign Het
Espl1 T C 15: 102,206,823 (GRCm39) Y96H probably damaging Het
Fam135a A T 1: 24,068,683 (GRCm39) L533I probably damaging Het
Fat2 G A 11: 55,201,910 (GRCm39) T388I probably benign Het
Galnt1 T G 18: 24,404,831 (GRCm39) probably benign Het
Glmn A G 5: 107,720,243 (GRCm39) F212S probably damaging Het
Gm3604 A T 13: 62,517,025 (GRCm39) N444K probably damaging Het
Gvin-ps5 A C 7: 105,928,888 (GRCm39) D336E probably damaging Het
H1f2 T C 13: 23,923,385 (GRCm39) V185A unknown Het
H1f3 A G 13: 23,739,690 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,678,390 (GRCm39) D145G probably damaging Het
Hic2 T A 16: 17,076,857 (GRCm39) L562Q probably damaging Het
Hip1r G T 5: 124,139,907 (GRCm39) E1003D probably damaging Het
Hsfy2 C T 1: 56,676,342 (GRCm39) C65Y probably benign Het
Inpp1 T C 1: 52,833,788 (GRCm39) T103A probably damaging Het
Ints5 T C 19: 8,872,260 (GRCm39) V73A probably damaging Het
Iqch A T 9: 63,455,298 (GRCm39) D166E probably benign Het
Klhdc3 A T 17: 46,988,901 (GRCm39) N96K probably damaging Het
Klk1b8 C T 7: 43,603,272 (GRCm39) probably benign Het
Klrb1 T C 6: 128,700,036 (GRCm39) probably null Het
Krt71 C A 15: 101,643,901 (GRCm39) G446* probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lemd3 G T 10: 120,814,845 (GRCm39) S129R probably damaging Het
Lrp1b A G 2: 40,748,453 (GRCm39) L3015P probably damaging Het
Mlst8 A T 17: 24,696,195 (GRCm39) I178N probably damaging Het
Mon2 A T 10: 122,874,388 (GRCm39) I320N probably damaging Het
Morc2b T C 17: 33,356,464 (GRCm39) Y436C probably damaging Het
Moxd1 T A 10: 24,155,781 (GRCm39) M295K probably benign Het
Mrps5 T A 2: 127,438,817 (GRCm39) probably null Het
Mtor C A 4: 148,552,730 (GRCm39) S744R probably damaging Het
Myo3a T A 2: 22,246,037 (GRCm39) D61E probably damaging Het
Nars1 C T 18: 64,633,635 (GRCm39) R545Q probably damaging Het
Ncoa6 A G 2: 155,248,741 (GRCm39) V1521A possibly damaging Het
Ndor1 T C 2: 25,145,305 (GRCm39) E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 (GRCm39) probably benign Het
Notch3 G T 17: 32,385,652 (GRCm39) A39E probably benign Het
Or1j16 A G 2: 36,530,227 (GRCm39) M59V possibly damaging Het
Or2a14 T C 6: 43,130,911 (GRCm39) I224T possibly damaging Het
Or6z3 G T 7: 6,464,144 (GRCm39) W212L probably benign Het
Otud3 T C 4: 138,625,343 (GRCm39) K237R possibly damaging Het
Papola T A 12: 105,794,532 (GRCm39) probably null Het
Parl T A 16: 20,121,077 (GRCm39) M1L possibly damaging Het
Parp14 G T 16: 35,678,671 (GRCm39) N432K probably benign Het
Patz1 T G 11: 3,241,088 (GRCm39) S159A probably damaging Het
Prpf6 T G 2: 181,273,870 (GRCm39) M338R probably benign Het
Psd3 A G 8: 68,149,727 (GRCm39) L343P probably damaging Het
Ptpn23 A T 9: 110,215,393 (GRCm39) N1422K probably damaging Het
Rab19 A T 6: 39,361,016 (GRCm39) T55S probably benign Het
Sh3yl1 A G 12: 30,972,332 (GRCm39) K34E possibly damaging Het
Skint8 T A 4: 111,807,278 (GRCm39) F321L possibly damaging Het
Slc25a46 A T 18: 31,733,294 (GRCm39) probably null Het
Slc26a3 T C 12: 31,500,815 (GRCm39) L184S probably damaging Het
Slc39a10 A T 1: 46,874,334 (GRCm39) S323T possibly damaging Het
Sorbs2 G T 8: 46,198,775 (GRCm39) R20L probably benign Het
Stk32a A T 18: 43,345,090 (GRCm39) D13V probably benign Het
Tab2 T C 10: 7,795,094 (GRCm39) T463A probably damaging Het
Tenm2 T A 11: 35,938,374 (GRCm39) N1433I possibly damaging Het
Tmem200c A T 17: 69,147,956 (GRCm39) I180F probably damaging Het
Tmem232 G T 17: 65,791,482 (GRCm39) H129N probably benign Het
Tmem242 T C 17: 5,489,854 (GRCm39) T47A possibly damaging Het
Ube2d1 A T 10: 71,120,953 (GRCm39) M1K probably null Het
Ube2frt A G 12: 36,140,595 (GRCm39) probably benign Het
Uckl1 T C 2: 181,212,320 (GRCm39) Q332R probably benign Het
Unc5b T C 10: 60,605,044 (GRCm39) probably benign Het
Vmn2r114 T C 17: 23,530,086 (GRCm39) Y107C probably benign Het
Vmn2r82 A T 10: 79,231,890 (GRCm39) S630C probably damaging Het
Wdr25 T A 12: 108,864,467 (GRCm39) V204E probably damaging Het
Xab2 T A 8: 3,666,094 (GRCm39) D227V probably damaging Het
Zfp286 A G 11: 62,674,534 (GRCm39) S104P possibly damaging Het
Zfp345 T C 2: 150,316,741 (GRCm39) D22G probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATTACTATGCAAATACCTTGAGGG -3'
(R):5'- GATGCTCATAAATGTTTGACCAAAG -3'

Sequencing Primer
(F):5'- CATGAAGGCATGTGTCACTATGC -3'
(R):5'- TGACCAAAGAGAAATAAACTTGAAGC -3'
Posted On 2014-08-01