Incidental Mutation 'R1954:Mdga2'
ID217594
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1954 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 66486708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably benign
Transcript: ENSMUST00000037181
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178724
Predicted Effect probably benign
Transcript: ENSMUST00000178814
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222167
Predicted Effect probably benign
Transcript: ENSMUST00000222623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222736
Predicted Effect probably benign
Transcript: ENSMUST00000222987
Predicted Effect probably benign
Transcript: ENSMUST00000223141
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Espl1 T C 15: 102,298,388 Y96H probably damaging Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Notch3 G T 17: 32,166,678 A39E probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr237-ps1 T C 6: 43,153,977 I224T possibly damaging Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Papola T A 12: 105,828,273 probably null Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tab2 T C 10: 7,919,330 T463A probably damaging Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTACTATGCAAATACCTTGAGGG -3'
(R):5'- GATGCTCATAAATGTTTGACCAAAG -3'

Sequencing Primer
(F):5'- CATGAAGGCATGTGTCACTATGC -3'
(R):5'- TGACCAAAGAGAAATAAACTTGAAGC -3'
Posted On2014-08-01