Incidental Mutation 'R1954:Papola'
ID217596
Institutional Source Beutler Lab
Gene Symbol Papola
Ensembl Gene ENSMUSG00000021111
Gene Namepoly (A) polymerase alpha
SynonymsPapIII, Plap
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R1954 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location105784694-105838944 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 105828273 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000109901] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000163473] [ENSMUST00000166329] [ENSMUST00000168186] [ENSMUST00000168186] [ENSMUST00000169938] [ENSMUST00000170002] [ENSMUST00000170002]
Predicted Effect probably benign
Transcript: ENSMUST00000021535
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109901
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109901
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163473
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163473
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164798
SMART Domains Protein: ENSMUSP00000125898
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 36 5.3e-8 PFAM
Pfam:PAP_RNA-bind 38 106 8.5e-22 PFAM
low complexity region 190 206 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164798
SMART Domains Protein: ENSMUSP00000125898
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 36 5.3e-8 PFAM
Pfam:PAP_RNA-bind 38 106 8.5e-22 PFAM
low complexity region 190 206 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166471
SMART Domains Protein: ENSMUSP00000132353
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 53 9.5e-21 PFAM
Pfam:PAP_RNA-bind 55 123 1.3e-21 PFAM
low complexity region 207 223 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166471
SMART Domains Protein: ENSMUSP00000132353
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 53 9.5e-21 PFAM
Pfam:PAP_RNA-bind 55 123 1.3e-21 PFAM
low complexity region 207 223 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168186
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168186
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169938
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170002
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170002
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172089
SMART Domains Protein: ENSMUSP00000131729
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Espl1 T C 15: 102,298,388 Y96H probably damaging Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mdga2 T C 12: 66,486,708 probably benign Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Notch3 G T 17: 32,166,678 A39E probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr237-ps1 T C 6: 43,153,977 I224T possibly damaging Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tab2 T C 10: 7,919,330 T463A probably damaging Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Papola
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Papola APN 12 105809597 nonsense probably null
IGL02197:Papola APN 12 105829183 missense possibly damaging 0.90
IGL02511:Papola APN 12 105809345 missense probably damaging 0.99
IGL02608:Papola APN 12 105809559 missense probably damaging 1.00
IGL03081:Papola APN 12 105818855 missense probably damaging 1.00
IGL03378:Papola APN 12 105809433 critical splice donor site probably null
IGL03401:Papola APN 12 105829122 missense probably benign 0.19
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0325:Papola UTSW 12 105807193 missense probably damaging 1.00
R0372:Papola UTSW 12 105818838 missense probably benign 0.05
R1553:Papola UTSW 12 105820410 missense probably benign 0.30
R1746:Papola UTSW 12 105807209 missense probably benign 0.12
R2424:Papola UTSW 12 105827052 missense probably benign 0.02
R4133:Papola UTSW 12 105799658 missense possibly damaging 0.83
R4156:Papola UTSW 12 105800751 critical splice donor site probably null
R4718:Papola UTSW 12 105820448 missense possibly damaging 0.72
R4814:Papola UTSW 12 105799653 missense probably damaging 1.00
R5115:Papola UTSW 12 105826960 missense probably benign 0.08
R5237:Papola UTSW 12 105826960 missense probably benign 0.08
R5372:Papola UTSW 12 105827050 missense probably benign 0.00
R5420:Papola UTSW 12 105806495 missense possibly damaging 0.95
R5430:Papola UTSW 12 105809584 missense probably damaging 1.00
R5831:Papola UTSW 12 105823600 missense probably benign 0.01
R5944:Papola UTSW 12 105812385 missense possibly damaging 0.87
R5956:Papola UTSW 12 105811041 missense probably damaging 1.00
R6143:Papola UTSW 12 105826960 missense probably benign 0.08
R6193:Papola UTSW 12 105820346 missense probably benign 0.42
R6413:Papola UTSW 12 105806504 start gained probably benign
R6490:Papola UTSW 12 105804937 missense probably benign 0.40
R6649:Papola UTSW 12 105812307 missense possibly damaging 0.72
R6891:Papola UTSW 12 105809691 unclassified probably benign
R7147:Papola UTSW 12 105808638 start gained probably benign
R7177:Papola UTSW 12 105809531 missense possibly damaging 0.95
R7178:Papola UTSW 12 105807184 missense probably damaging 1.00
R7256:Papola UTSW 12 105809345 missense probably damaging 0.99
R7583:Papola UTSW 12 105811045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTACATCAGTTTTGTCAGCT -3'
(R):5'- GCCAGGGCTATACAGTGGTC -3'

Sequencing Primer
(F):5'- TCGAACTCTGTAGACCAAGCTGG -3'
(R):5'- GGCTATACAGTGGTCCTGAAAAC -3'
Posted On2014-08-01