Incidental Mutation 'R1954:Espl1'
ID217604
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1954 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102298388 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 96 (Y96H)
Ref Sequence ENSEMBL: ENSMUSP00000155469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: Y96H

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably damaging
Transcript: ENSMUST00000230212
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231104
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mdga2 T C 12: 66,486,708 probably benign Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Notch3 G T 17: 32,166,678 A39E probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr237-ps1 T C 6: 43,153,977 I224T possibly damaging Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Papola T A 12: 105,828,273 probably null Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tab2 T C 10: 7,919,330 T463A probably damaging Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCCCGGACTGATTTCC -3'
(R):5'- TTCAGCCGAGTTGAGAACGC -3'

Sequencing Primer
(F):5'- GACTGATTTCCCCAGCAGC -3'
(R):5'- AGTTGAGAACGCAGCTCGC -3'
Posted On2014-08-01