Mutagenetix > Incidental Mutation

Incidental Mutation 'R1954:Espl1'

217604

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039968-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1954 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102298388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 96 (Y96H)

Ref Sequence

ENSEMBL: ENSMUSP00000155469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: Y96H

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

probably damaging
Transcript: ENSMUST00000230212
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231104
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4222

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,566,753		probably benign	Het
Adamts15	T	A	9: 30,910,708	M478L	probably benign	Het
Akap8l	T	A	17: 32,336,736	Y123F	possibly damaging	Het
Anapc4	T	G	5: 52,846,625		probably benign	Het
Arap3	A	G	18: 37,982,002	V987A	probably damaging	Het
Atp2b4	T	A	1: 133,739,992	T105S	probably damaging	Het
Atp6v0d1	A	G	8: 105,565,893	L7P	probably damaging	Het
Atp6v1b2	T	C	8: 69,105,903	V341A	possibly damaging	Het
Baz2b	C	A	2: 59,968,743	A346S	probably benign	Het
Brpf3	G	A	17: 28,806,559	S202N	probably benign	Het
Btnl4	T	C	17: 34,472,930	K233E	possibly damaging	Het
Capn7	A	G	14: 31,360,150	T438A	probably damaging	Het
Cars2	A	T	8: 11,550,286	Y68N	probably damaging	Het
Cbx2	G	T	11: 119,028,340	G244W	probably damaging	Het
Ccr4	A	T	9: 114,492,685	V104D	probably damaging	Het
Cdc5l	T	C	17: 45,426,516		probably null	Het
Cep170	A	T	1: 176,756,384	C810S	probably benign	Het
Clp1	T	C	2: 84,724,051	D258G	probably damaging	Het
Clstn3	T	C	6: 124,459,298	E164G	possibly damaging	Het
Col28a1	T	C	6: 7,998,516	E1131G	probably damaging	Het
Cps1	A	G	1: 67,195,196	D914G	possibly damaging	Het
Ctnnal1	C	T	4: 56,817,242		probably benign	Het
Cyp2c38	A	G	19: 39,404,687	L312P	probably damaging	Het
Cytip	T	C	2: 58,148,253	N99D	possibly damaging	Het
Dennd4a	A	T	9: 64,852,467	T285S	probably benign	Het
Dhx8	A	G	11: 101,753,279	S842G	probably damaging	Het
Disp1	A	T	1: 183,088,543	M771K	probably damaging	Het
Dnah17	A	G	11: 118,024,731	I4326T	probably damaging	Het
Efcab7	T	C	4: 99,900,690	F345L	probably damaging	Het
Erc1	G	T	6: 119,797,305	Q230K	probably damaging	Het
Ern1	A	T	11: 106,421,974		probably benign	Het
Fam135a	A	T	1: 24,029,602	L533I	probably damaging	Het
Fat2	G	A	11: 55,311,084	T388I	probably benign	Het
Galnt1	T	G	18: 24,271,774		probably benign	Het
Glmn	A	G	5: 107,572,377	F212S	probably damaging	Het
Gm3604	A	T	13: 62,369,211	N444K	probably damaging	Het
Gm5434	A	G	12: 36,090,596		probably benign	Het
Gm8989	A	C	7: 106,329,681	D336E	probably damaging	Het
H2-M10.3	T	C	17: 36,367,498	D145G	probably damaging	Het
Hic2	T	A	16: 17,258,993	L562Q	probably damaging	Het
Hip1r	G	T	5: 124,001,844	E1003D	probably damaging	Het
Hist1h1c	T	C	13: 23,739,402	V185A	unknown	Het
Hist1h1d	A	G	13: 23,555,516		probably benign	Het
Hsfy2	C	T	1: 56,637,183	C65Y	probably benign	Het
Inpp1	T	C	1: 52,794,629	T103A	probably damaging	Het
Ints5	T	C	19: 8,894,896	V73A	probably damaging	Het
Iqch	A	T	9: 63,548,016	D166E	probably benign	Het
Klhdc3	A	T	17: 46,677,975	N96K	probably damaging	Het
Klk1b8	C	T	7: 43,953,848		probably benign	Het
Klrb1	T	C	6: 128,723,073		probably null	Het
Krt71	C	A	15: 101,735,466	G446*	probably null	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lemd3	G	T	10: 120,978,940	S129R	probably damaging	Het
Lrp1b	A	G	2: 40,858,441	L3015P	probably damaging	Het
Mdga2	T	C	12: 66,486,708		probably benign	Het
Mlst8	A	T	17: 24,477,221	I178N	probably damaging	Het
Mon2	A	T	10: 123,038,483	I320N	probably damaging	Het
Morc2b	T	C	17: 33,137,490	Y436C	probably damaging	Het
Moxd1	T	A	10: 24,279,883	M295K	probably benign	Het
Mrps5	T	A	2: 127,596,897		probably null	Het
Mtor	C	A	4: 148,468,273	S744R	probably damaging	Het
Myo3a	T	A	2: 22,241,226	D61E	probably damaging	Het
Nars	C	T	18: 64,500,564	R545Q	probably damaging	Het
Ncoa6	A	G	2: 155,406,821	V1521A	possibly damaging	Het
Ndor1	T	C	2: 25,255,293	E20G	possibly damaging	Het
Nipsnap3b	T	C	4: 53,017,213		probably benign	Het
Notch3	G	T	17: 32,166,678	A39E	probably benign	Het
Olfr1336	G	T	7: 6,461,145	W212L	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,977	I224T	possibly damaging	Het
Olfr345	A	G	2: 36,640,215	M59V	possibly damaging	Het
Otud3	T	C	4: 138,898,032	K237R	possibly damaging	Het
Papola	T	A	12: 105,828,273		probably null	Het
Parl	T	A	16: 20,302,327	M1L	possibly damaging	Het
Parp14	G	T	16: 35,858,301	N432K	probably benign	Het
Patz1	T	G	11: 3,291,088	S159A	probably damaging	Het
Prpf6	T	G	2: 181,632,077	M338R	probably benign	Het
Psd3	A	G	8: 67,697,075	L343P	probably damaging	Het
Ptpn23	A	T	9: 110,386,325	N1422K	probably damaging	Het
Rab19	A	T	6: 39,384,082	T55S	probably benign	Het
Sh3yl1	A	G	12: 30,922,333	K34E	possibly damaging	Het
Skint8	T	A	4: 111,950,081	F321L	possibly damaging	Het
Slc25a46	A	T	18: 31,600,241		probably null	Het
Slc26a3	T	C	12: 31,450,816	L184S	probably damaging	Het
Slc39a10	A	T	1: 46,835,174	S323T	possibly damaging	Het
Sorbs2	G	T	8: 45,745,738	R20L	probably benign	Het
Stk32a	A	T	18: 43,212,025	D13V	probably benign	Het
Tab2	T	C	10: 7,919,330	T463A	probably damaging	Het
Tenm2	T	A	11: 36,047,547	N1433I	possibly damaging	Het
Tmem200c	A	T	17: 68,840,961	I180F	probably damaging	Het
Tmem232	G	T	17: 65,484,487	H129N	probably benign	Het
Tmem242	T	C	17: 5,439,579	T47A	possibly damaging	Het
Ube2d1	A	T	10: 71,285,123	M1K	probably null	Het
Uckl1	T	C	2: 181,570,527	Q332R	probably benign	Het
Unc5b	T	C	10: 60,769,265		probably benign	Het
Vmn2r114	T	C	17: 23,311,112	Y107C	probably benign	Het
Vmn2r82	A	T	10: 79,396,056	S630C	probably damaging	Het
Wdr25	T	A	12: 108,898,541	V204E	probably damaging	Het
Xab2	T	A	8: 3,616,094	D227V	probably damaging	Het
Zfp286	A	G	11: 62,783,708	S104P	possibly damaging	Het
Zfp345	T	C	2: 150,474,821	D22G	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATCCCGGACTGATTTCC -3'
(R):5'- TTCAGCCGAGTTGAGAACGC -3'

Sequencing Primer
(F):5'- GACTGATTTCCCCAGCAGC -3'
(R):5'- AGTTGAGAACGCAGCTCGC -3'

Posted On

2014-08-01