Incidental Mutation 'R1954:Espl1'
ID 217604
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 039968-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1954 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102206823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 96 (Y96H)
Ref Sequence ENSEMBL: ENSMUSP00000155469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: Y96H

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably damaging
Transcript: ENSMUST00000230212
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231104
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,822,004 (GRCm39) M478L probably benign Het
Akap8l T A 17: 32,555,710 (GRCm39) Y123F possibly damaging Het
Anapc4 T G 5: 53,003,967 (GRCm39) probably benign Het
Arap3 A G 18: 38,115,055 (GRCm39) V987A probably damaging Het
Atp2b4 T A 1: 133,667,730 (GRCm39) T105S probably damaging Het
Atp6v0d1 A G 8: 106,292,525 (GRCm39) L7P probably damaging Het
Atp6v1b2 T C 8: 69,558,555 (GRCm39) V341A possibly damaging Het
Baz2b C A 2: 59,799,087 (GRCm39) A346S probably benign Het
Brpf3 G A 17: 29,025,533 (GRCm39) S202N probably benign Het
Btnl4 T C 17: 34,691,904 (GRCm39) K233E possibly damaging Het
Capn7 A G 14: 31,082,107 (GRCm39) T438A probably damaging Het
Cars2 A T 8: 11,600,286 (GRCm39) Y68N probably damaging Het
Cbx2 G T 11: 118,919,166 (GRCm39) G244W probably damaging Het
Ccr4 A T 9: 114,321,753 (GRCm39) V104D probably damaging Het
Cdc5l T C 17: 45,737,442 (GRCm39) probably null Het
Cep170 A T 1: 176,583,950 (GRCm39) C810S probably benign Het
Cfap299 A T 5: 98,714,612 (GRCm39) probably benign Het
Clp1 T C 2: 84,554,395 (GRCm39) D258G probably damaging Het
Clstn3 T C 6: 124,436,257 (GRCm39) E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 (GRCm39) E1131G probably damaging Het
Cps1 A G 1: 67,234,355 (GRCm39) D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 (GRCm39) probably benign Het
Cyp2c38 A G 19: 39,393,131 (GRCm39) L312P probably damaging Het
Cytip T C 2: 58,038,265 (GRCm39) N99D possibly damaging Het
Dennd4a A T 9: 64,759,749 (GRCm39) T285S probably benign Het
Dhx8 A G 11: 101,644,105 (GRCm39) S842G probably damaging Het
Disp1 A T 1: 182,870,107 (GRCm39) M771K probably damaging Het
Dnah17 A G 11: 117,915,557 (GRCm39) I4326T probably damaging Het
Efcab7 T C 4: 99,757,887 (GRCm39) F345L probably damaging Het
Erc1 G T 6: 119,774,266 (GRCm39) Q230K probably damaging Het
Ern1 A T 11: 106,312,800 (GRCm39) probably benign Het
Fam135a A T 1: 24,068,683 (GRCm39) L533I probably damaging Het
Fat2 G A 11: 55,201,910 (GRCm39) T388I probably benign Het
Galnt1 T G 18: 24,404,831 (GRCm39) probably benign Het
Glmn A G 5: 107,720,243 (GRCm39) F212S probably damaging Het
Gm3604 A T 13: 62,517,025 (GRCm39) N444K probably damaging Het
Gvin-ps5 A C 7: 105,928,888 (GRCm39) D336E probably damaging Het
H1f2 T C 13: 23,923,385 (GRCm39) V185A unknown Het
H1f3 A G 13: 23,739,690 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,678,390 (GRCm39) D145G probably damaging Het
Hic2 T A 16: 17,076,857 (GRCm39) L562Q probably damaging Het
Hip1r G T 5: 124,139,907 (GRCm39) E1003D probably damaging Het
Hsfy2 C T 1: 56,676,342 (GRCm39) C65Y probably benign Het
Inpp1 T C 1: 52,833,788 (GRCm39) T103A probably damaging Het
Ints5 T C 19: 8,872,260 (GRCm39) V73A probably damaging Het
Iqch A T 9: 63,455,298 (GRCm39) D166E probably benign Het
Klhdc3 A T 17: 46,988,901 (GRCm39) N96K probably damaging Het
Klk1b8 C T 7: 43,603,272 (GRCm39) probably benign Het
Klrb1 T C 6: 128,700,036 (GRCm39) probably null Het
Krt71 C A 15: 101,643,901 (GRCm39) G446* probably null Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lemd3 G T 10: 120,814,845 (GRCm39) S129R probably damaging Het
Lrp1b A G 2: 40,748,453 (GRCm39) L3015P probably damaging Het
Mdga2 T C 12: 66,533,482 (GRCm39) probably benign Het
Mlst8 A T 17: 24,696,195 (GRCm39) I178N probably damaging Het
Mon2 A T 10: 122,874,388 (GRCm39) I320N probably damaging Het
Morc2b T C 17: 33,356,464 (GRCm39) Y436C probably damaging Het
Moxd1 T A 10: 24,155,781 (GRCm39) M295K probably benign Het
Mrps5 T A 2: 127,438,817 (GRCm39) probably null Het
Mtor C A 4: 148,552,730 (GRCm39) S744R probably damaging Het
Myo3a T A 2: 22,246,037 (GRCm39) D61E probably damaging Het
Nars1 C T 18: 64,633,635 (GRCm39) R545Q probably damaging Het
Ncoa6 A G 2: 155,248,741 (GRCm39) V1521A possibly damaging Het
Ndor1 T C 2: 25,145,305 (GRCm39) E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 (GRCm39) probably benign Het
Notch3 G T 17: 32,385,652 (GRCm39) A39E probably benign Het
Or1j16 A G 2: 36,530,227 (GRCm39) M59V possibly damaging Het
Or2a14 T C 6: 43,130,911 (GRCm39) I224T possibly damaging Het
Or6z3 G T 7: 6,464,144 (GRCm39) W212L probably benign Het
Otud3 T C 4: 138,625,343 (GRCm39) K237R possibly damaging Het
Papola T A 12: 105,794,532 (GRCm39) probably null Het
Parl T A 16: 20,121,077 (GRCm39) M1L possibly damaging Het
Parp14 G T 16: 35,678,671 (GRCm39) N432K probably benign Het
Patz1 T G 11: 3,241,088 (GRCm39) S159A probably damaging Het
Prpf6 T G 2: 181,273,870 (GRCm39) M338R probably benign Het
Psd3 A G 8: 68,149,727 (GRCm39) L343P probably damaging Het
Ptpn23 A T 9: 110,215,393 (GRCm39) N1422K probably damaging Het
Rab19 A T 6: 39,361,016 (GRCm39) T55S probably benign Het
Sh3yl1 A G 12: 30,972,332 (GRCm39) K34E possibly damaging Het
Skint8 T A 4: 111,807,278 (GRCm39) F321L possibly damaging Het
Slc25a46 A T 18: 31,733,294 (GRCm39) probably null Het
Slc26a3 T C 12: 31,500,815 (GRCm39) L184S probably damaging Het
Slc39a10 A T 1: 46,874,334 (GRCm39) S323T possibly damaging Het
Sorbs2 G T 8: 46,198,775 (GRCm39) R20L probably benign Het
Stk32a A T 18: 43,345,090 (GRCm39) D13V probably benign Het
Tab2 T C 10: 7,795,094 (GRCm39) T463A probably damaging Het
Tenm2 T A 11: 35,938,374 (GRCm39) N1433I possibly damaging Het
Tmem200c A T 17: 69,147,956 (GRCm39) I180F probably damaging Het
Tmem232 G T 17: 65,791,482 (GRCm39) H129N probably benign Het
Tmem242 T C 17: 5,489,854 (GRCm39) T47A possibly damaging Het
Ube2d1 A T 10: 71,120,953 (GRCm39) M1K probably null Het
Ube2frt A G 12: 36,140,595 (GRCm39) probably benign Het
Uckl1 T C 2: 181,212,320 (GRCm39) Q332R probably benign Het
Unc5b T C 10: 60,605,044 (GRCm39) probably benign Het
Vmn2r114 T C 17: 23,530,086 (GRCm39) Y107C probably benign Het
Vmn2r82 A T 10: 79,231,890 (GRCm39) S630C probably damaging Het
Wdr25 T A 12: 108,864,467 (GRCm39) V204E probably damaging Het
Xab2 T A 8: 3,666,094 (GRCm39) D227V probably damaging Het
Zfp286 A G 11: 62,674,534 (GRCm39) S104P possibly damaging Het
Zfp345 T C 2: 150,316,741 (GRCm39) D22G probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCCCGGACTGATTTCC -3'
(R):5'- TTCAGCCGAGTTGAGAACGC -3'

Sequencing Primer
(F):5'- GACTGATTTCCCCAGCAGC -3'
(R):5'- AGTTGAGAACGCAGCTCGC -3'
Posted On 2014-08-01