Incidental Mutation 'R0133:Kcnc2'
ID21767
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0133 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112458597 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 579 (C579R)
Ref Sequence ENSEMBL: ENSMUSP00000089814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000218445] [ENSMUST00000218827] [ENSMUST00000219301] [ENSMUST00000219607]
Predicted Effect probably damaging
Transcript: ENSMUST00000092175
AA Change: C579R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: C579R

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218445
AA Change: C177R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect silent
Transcript: ENSMUST00000218827
Predicted Effect probably damaging
Transcript: ENSMUST00000219301
AA Change: C579R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219607
AA Change: C130R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.3075 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4504:Kcnc2 UTSW 10 112455794 missense probably damaging 1.00
R4714:Kcnc2 UTSW 10 112455828 missense possibly damaging 0.82
R4935:Kcnc2 UTSW 10 112272228 missense probably benign 0.00
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6609:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6612:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
R7715:Kcnc2 UTSW 10 112271940 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTGTGAGAAAGCTAACTGCCC -3'
(R):5'- TGCGCTCCTTGGAAAATGACGAC -3'

Sequencing Primer
(F):5'- GACTACGGGCATCTGTTGTAAAC -3'
(R):5'- AAATGACGACTGAGCGTTTTGC -3'
Posted On2013-04-12