Incidental Mutation 'R1955:Myo7a'
ID217675
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
MMRRC Submission 039969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1955 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98054921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1928 (V1928D)
Ref Sequence ENSEMBL: ENSMUSP00000102744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000156992] [ENSMUST00000205746]
PDB Structure
Structure of myosin VIIa MyTH4-FERM-SH3 in complex with the CEN1 of Sans [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000084979
AA Change: V1917D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: V1917D

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: V1923D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: V1923D

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107127
AA Change: V1928D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: V1928D

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107128
AA Change: V1966D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: V1966D

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156992
Predicted Effect probably damaging
Transcript: ENSMUST00000205746
AA Change: V1917D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T A 1: 53,163,241 K128N probably benign Het
4930430F08Rik A G 10: 100,577,304 V91A probably damaging Het
Acadm A C 3: 153,929,551 F309V probably damaging Het
Adam6b C A 12: 113,491,816 A751E probably benign Het
Adcy9 A G 16: 4,418,659 I296T possibly damaging Het
Arhgap45 A G 10: 80,026,492 E471G probably benign Het
Atcay T C 10: 81,214,793 D96G possibly damaging Het
B3galt4 T A 17: 33,950,632 R211* probably null Het
Bpi T C 2: 158,274,715 I344T probably damaging Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cd207 T A 6: 83,671,775 R302W probably benign Het
Cdc5l T C 17: 45,426,516 probably null Het
Chaf1a C T 17: 56,047,540 T270I unknown Het
Col4a1 C T 8: 11,208,228 probably null Het
Col7a1 G T 9: 108,955,664 V187L unknown Het
Cry1 G A 10: 85,144,178 T422I probably benign Het
Csgalnact1 C T 8: 68,372,667 V392I probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Ddx20 G A 3: 105,679,562 T489M possibly damaging Het
Decr1 A T 4: 15,924,256 N221K probably benign Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dgka A G 10: 128,730,189 probably null Het
Dmd A T X: 83,878,557 M1478L probably benign Het
Dvl1 G A 4: 155,858,029 R584Q possibly damaging Het
Dync1li1 A T 9: 114,721,746 S450C probably damaging Het
Ehbp1l1 A G 19: 5,710,669 V1558A possibly damaging Het
Esr1 T A 10: 4,857,125 M347K probably damaging Het
F2 T A 2: 91,633,095 H148L probably benign Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fscn3 T A 6: 28,430,236 M135K possibly damaging Het
Ganab T G 19: 8,911,616 Y560* probably null Het
Garem2 T C 5: 30,108,270 V44A probably benign Het
Gja4 A G 4: 127,312,449 W174R probably damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Gm43517 A G 12: 49,389,889 probably benign Het
Gm5434 A G 12: 36,090,596 probably benign Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Kifc5b T A 17: 26,926,297 probably null Het
Kmt2b A T 7: 30,575,351 M1976K possibly damaging Het
Leng1 A T 7: 3,665,416 V11D probably damaging Het
Lrit3 A G 3: 129,800,481 V149A probably benign Het
Lrpap1 A G 5: 35,102,412 L114P probably damaging Het
Marveld3 T A 8: 109,959,748 D162V probably benign Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Nexmif A G X: 104,083,953 S1453P possibly damaging Het
Nudt16l1 A G 16: 4,940,325 M182V probably benign Het
Obp2b A T 2: 25,738,551 I106L probably benign Het
Olfr1129 T A 2: 87,576,005 L307Q probably damaging Het
Olfr1239 T A 2: 89,418,411 M1L probably damaging Het
Olfr186 T A 16: 59,027,411 R165S probably damaging Het
Olfr902 T C 9: 38,449,688 I272T probably benign Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Pde7a G A 3: 19,227,799 A429V probably damaging Het
Pkd1l2 T A 8: 117,043,361 M1119L probably benign Het
Plch1 C T 3: 63,755,267 V272I probably damaging Het
Plekha4 G A 7: 45,553,906 G740D probably damaging Het
Pnliprp1 A G 19: 58,734,972 D265G possibly damaging Het
Pola1 A C X: 93,597,261 V384G probably damaging Het
Pon3 T A 6: 5,230,774 D251V probably benign Het
Pot1b A G 17: 55,674,067 C316R possibly damaging Het
Prkaca T A 8: 83,988,317 V116E probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Rasgef1c A G 11: 49,975,715 H382R possibly damaging Het
Rps25 C T 9: 44,410,008 T113I probably benign Het
Serpinb1b G T 13: 33,085,439 A52S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Siah2 C T 3: 58,676,097 R256Q probably damaging Het
Slc24a2 A G 4: 87,073,244 L404P probably damaging Het
Slc28a2 G A 2: 122,447,866 C122Y probably benign Het
Slc4a8 T C 15: 100,807,376 I821T probably damaging Het
Slc5a3 T C 16: 92,077,874 V273A possibly damaging Het
Spag7 T C 11: 70,665,018 Q61R probably benign Het
Syt7 A T 19: 10,418,038 I71F probably damaging Het
Tars2 T C 3: 95,747,454 N413S probably damaging Het
Tex14 T A 11: 87,509,621 L413Q probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Tmem131l A G 3: 83,961,544 S175P probably damaging Het
Tmem144 C T 3: 79,826,857 V180M probably benign Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmprss11g T A 5: 86,498,532 I59F probably damaging Het
Tmprss2 T A 16: 97,567,177 probably null Het
Tor1aip2 T A 1: 156,051,842 probably benign Het
Trim61 T C 8: 65,013,392 I406V possibly damaging Het
Trpv5 T C 6: 41,657,937 D486G probably damaging Het
Try5 T C 6: 41,311,769 E64G probably benign Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Ugt2b1 T C 5: 86,917,713 Y489C probably damaging Het
Ugt2b5 T A 5: 87,127,772 M407L probably benign Het
Vmn1r191 A T 13: 22,178,815 S256R possibly damaging Het
Vps13b T G 15: 35,925,408 probably null Het
Vps13d A G 4: 145,156,143 F960S probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Xaf1 A T 11: 72,306,606 D136V possibly damaging Het
Zan A G 5: 137,389,283 S4889P unknown Het
Zfp78 A G 7: 6,378,559 T203A probably benign Het
Zfp821 T C 8: 109,721,242 S72P probably damaging Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6465:Myo7a UTSW 7 98062680 missense possibly damaging 0.95
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7422:Myo7a UTSW 7 98051626 splice site probably null
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
R7526:Myo7a UTSW 7 98085448 missense possibly damaging 0.49
R7948:Myo7a UTSW 7 98075029 missense probably damaging 1.00
R8069:Myo7a UTSW 7 98083626 nonsense probably null
R8115:Myo7a UTSW 7 98066446 missense probably damaging 0.98
R8150:Myo7a UTSW 7 98063639 missense probably benign 0.19
R8265:Myo7a UTSW 7 98085397 missense probably benign 0.00
R8289:Myo7a UTSW 7 98077169 missense probably benign
R8298:Myo7a UTSW 7 98098334 missense probably damaging 1.00
R8518:Myo7a UTSW 7 98091063 missense possibly damaging 0.58
RF005:Myo7a UTSW 7 98093617 missense probably benign 0.42
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Z1176:Myo7a UTSW 7 98095727 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98052226 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98085523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTCATGAAGAACACCTGGTAGG -3'
(R):5'- TTCCCGAGATGCTAACGAGG -3'

Sequencing Primer
(F):5'- ACGATTCCTGTGGCACAG -3'
(R):5'- TGCTAACGAGGCACCAGTG -3'
Posted On2014-08-01