Mutagenetix > Incidental Mutation

Incidental Mutation 'R1955:Csgalnact1'

217680

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

039969-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R1955 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68372667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 392 (V392I)

Ref Sequence

ENSEMBL: ENSMUSP00000119817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214]

AlphaFold

Q8BJQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000078350
AA Change: V392I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: V392I

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124929

Predicted Effect

probably benign
Transcript: ENSMUST00000130214
AA Change: V392I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: V392I

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139265

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	T	A	1: 53,163,241	K128N	probably benign	Het
4930430F08Rik	A	G	10: 100,577,304	V91A	probably damaging	Het
Acadm	A	C	3: 153,929,551	F309V	probably damaging	Het
Adam6b	C	A	12: 113,491,816	A751E	probably benign	Het
Adcy9	A	G	16: 4,418,659	I296T	possibly damaging	Het
Arhgap45	A	G	10: 80,026,492	E471G	probably benign	Het
Atcay	T	C	10: 81,214,793	D96G	possibly damaging	Het
B3galt4	T	A	17: 33,950,632	R211*	probably null	Het
Bpi	T	C	2: 158,274,715	I344T	probably damaging	Het
Btnl4	T	C	17: 34,472,930	K233E	possibly damaging	Het
Cars2	A	T	8: 11,550,286	Y68N	probably damaging	Het
Cd207	T	A	6: 83,671,775	R302W	probably benign	Het
Cdc5l	T	C	17: 45,426,516		probably null	Het
Chaf1a	C	T	17: 56,047,540	T270I	unknown	Het
Col4a1	C	T	8: 11,208,228		probably null	Het
Col7a1	G	T	9: 108,955,664	V187L	unknown	Het
Cry1	G	A	10: 85,144,178	T422I	probably benign	Het
Cyp2c38	A	G	19: 39,404,687	L312P	probably damaging	Het
Ddx20	G	A	3: 105,679,562	T489M	possibly damaging	Het
Decr1	A	T	4: 15,924,256	N221K	probably benign	Het
Dennd4a	A	T	9: 64,852,467	T285S	probably benign	Het
Dgka	A	G	10: 128,730,189		probably null	Het
Dmd	A	T	X: 83,878,557	M1478L	probably benign	Het
Dvl1	G	A	4: 155,858,029	R584Q	possibly damaging	Het
Dync1li1	A	T	9: 114,721,746	S450C	probably damaging	Het
Ehbp1l1	A	G	19: 5,710,669	V1558A	possibly damaging	Het
Esr1	T	A	10: 4,857,125	M347K	probably damaging	Het
F2	T	A	2: 91,633,095	H148L	probably benign	Het
Fezf2	T	C	14: 12,342,644	N407S	probably benign	Het
Fscn3	T	A	6: 28,430,236	M135K	possibly damaging	Het
Ganab	T	G	19: 8,911,616	Y560*	probably null	Het
Garem2	T	C	5: 30,108,270	V44A	probably benign	Het
Gja4	A	G	4: 127,312,449	W174R	probably damaging	Het
Gja5	A	T	3: 97,051,641	H338L	probably benign	Het
Gm43517	A	G	12: 49,389,889		probably benign	Het
Gm5434	A	G	12: 36,090,596		probably benign	Het
Iqch	A	T	9: 63,548,016	D166E	probably benign	Het
Kifc5b	T	A	17: 26,926,297		probably null	Het
Kmt2b	A	T	7: 30,575,351	M1976K	possibly damaging	Het
Leng1	A	T	7: 3,665,416	V11D	probably damaging	Het
Lrit3	A	G	3: 129,800,481	V149A	probably benign	Het
Lrpap1	A	G	5: 35,102,412	L114P	probably damaging	Het
Marveld3	T	A	8: 109,959,748	D162V	probably benign	Het
Mon2	A	T	10: 123,038,483	I320N	probably damaging	Het
Morc2b	T	C	17: 33,137,490	Y436C	probably damaging	Het
Myo7a	A	T	7: 98,054,921	V1928D	probably damaging	Het
Ncoa6	A	G	2: 155,406,821	V1521A	possibly damaging	Het
Nexmif	A	G	X: 104,083,953	S1453P	possibly damaging	Het
Nudt16l1	A	G	16: 4,940,325	M182V	probably benign	Het
Obp2b	A	T	2: 25,738,551	I106L	probably benign	Het
Olfr1129	T	A	2: 87,576,005	L307Q	probably damaging	Het
Olfr1239	T	A	2: 89,418,411	M1L	probably damaging	Het
Olfr186	T	A	16: 59,027,411	R165S	probably damaging	Het
Olfr902	T	C	9: 38,449,688	I272T	probably benign	Het
Parl	T	A	16: 20,302,327	M1L	possibly damaging	Het
Pde7a	G	A	3: 19,227,799	A429V	probably damaging	Het
Pkd1l2	T	A	8: 117,043,361	M1119L	probably benign	Het
Plch1	C	T	3: 63,755,267	V272I	probably damaging	Het
Plekha4	G	A	7: 45,553,906	G740D	probably damaging	Het
Pnliprp1	A	G	19: 58,734,972	D265G	possibly damaging	Het
Pola1	A	C	X: 93,597,261	V384G	probably damaging	Het
Pon3	T	A	6: 5,230,774	D251V	probably benign	Het
Pot1b	A	G	17: 55,674,067	C316R	possibly damaging	Het
Prkaca	T	A	8: 83,988,317	V116E	probably damaging	Het
Prpf6	T	G	2: 181,632,077	M338R	probably benign	Het
Rasgef1c	A	G	11: 49,975,715	H382R	possibly damaging	Het
Rps25	C	T	9: 44,410,008	T113I	probably benign	Het
Serpinb1b	G	T	13: 33,085,439	A52S	probably benign	Het
Sh3yl1	A	G	12: 30,922,333	K34E	possibly damaging	Het
Siah2	C	T	3: 58,676,097	R256Q	probably damaging	Het
Slc24a2	A	G	4: 87,073,244	L404P	probably damaging	Het
Slc28a2	G	A	2: 122,447,866	C122Y	probably benign	Het
Slc4a8	T	C	15: 100,807,376	I821T	probably damaging	Het
Slc5a3	T	C	16: 92,077,874	V273A	possibly damaging	Het
Spag7	T	C	11: 70,665,018	Q61R	probably benign	Het
Syt7	A	T	19: 10,418,038	I71F	probably damaging	Het
Tars2	T	C	3: 95,747,454	N413S	probably damaging	Het
Tex14	T	A	11: 87,509,621	L413Q	probably damaging	Het
Tjp3	T	C	10: 81,277,999	E475G	probably damaging	Het
Tmem131l	A	G	3: 83,961,544	S175P	probably damaging	Het
Tmem144	C	T	3: 79,826,857	V180M	probably benign	Het
Tmem200c	A	T	17: 68,840,961	I180F	probably damaging	Het
Tmem232	G	T	17: 65,484,487	H129N	probably benign	Het
Tmprss11g	T	A	5: 86,498,532	I59F	probably damaging	Het
Tmprss2	T	A	16: 97,567,177		probably null	Het
Tor1aip2	T	A	1: 156,051,842		probably benign	Het
Trim61	T	C	8: 65,013,392	I406V	possibly damaging	Het
Trpv5	T	C	6: 41,657,937	D486G	probably damaging	Het
Try5	T	C	6: 41,311,769	E64G	probably benign	Het
Txlnb	A	G	10: 17,799,420	E107G	probably damaging	Het
Uckl1	T	C	2: 181,570,527	Q332R	probably benign	Het
Ugt2b1	T	C	5: 86,917,713	Y489C	probably damaging	Het
Ugt2b5	T	A	5: 87,127,772	M407L	probably benign	Het
Vmn1r191	A	T	13: 22,178,815	S256R	possibly damaging	Het
Vps13b	T	G	15: 35,925,408		probably null	Het
Vps13d	A	G	4: 145,156,143	F960S	probably damaging	Het
Xab2	T	A	8: 3,616,094	D227V	probably damaging	Het
Xaf1	A	T	11: 72,306,606	D136V	possibly damaging	Het
Zan	A	G	5: 137,389,283	S4889P	unknown	Het
Zfp78	A	G	7: 6,378,559	T203A	probably benign	Het
Zfp821	T	C	8: 109,721,242	S72P	probably damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
R9619:Csgalnact1	UTSW	8	68401354	missense	probably damaging	0.99
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAAGGCTGGAAAATCTGC -3'
(R):5'- CACTTAATGGTCTAGCTGGTGG -3'

Sequencing Primer
(F):5'- GCTGGAAAATCTGCCAAACG -3'
(R):5'- GGTTACTTCTGAGATCTAGCCTAGAC -3'

Posted On

2014-08-01