Incidental Mutation 'R1955:Zfp821'
ID217682
Institutional Source Beutler Lab
Gene Symbol Zfp821
Ensembl Gene ENSMUSG00000031728
Gene Namezinc finger protein 821
Synonyms
MMRRC Submission 039969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1955 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109705546-109724932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109721242 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000148348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034163] [ENSMUST00000212000] [ENSMUST00000212192] [ENSMUST00000212964]
Predicted Effect probably damaging
Transcript: ENSMUST00000034163
AA Change: S72P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034163
Gene: ENSMUSG00000031728
AA Change: S72P

DomainStartEndE-ValueType
low complexity region 50 69 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 119 141 3.78e-1 SMART
ZnF_C2H2 151 173 7.26e-3 SMART
coiled coil region 260 334 N/A INTRINSIC
low complexity region 342 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211918
Predicted Effect probably damaging
Transcript: ENSMUST00000212000
AA Change: S72P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212192
AA Change: S72P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212233
Predicted Effect probably benign
Transcript: ENSMUST00000212964
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two C2H2 zinc finger motifs and a score-and-three (23)-amino acid peptide repeat (STPR) domain. The STPR domain of the encoded protein binds to double stranded DNA and may also contain a nuclear localization signal, suggesting that this protein interacts with chromosomal DNA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T A 1: 53,163,241 K128N probably benign Het
4930430F08Rik A G 10: 100,577,304 V91A probably damaging Het
Acadm A C 3: 153,929,551 F309V probably damaging Het
Adam6b C A 12: 113,491,816 A751E probably benign Het
Adcy9 A G 16: 4,418,659 I296T possibly damaging Het
Arhgap45 A G 10: 80,026,492 E471G probably benign Het
Atcay T C 10: 81,214,793 D96G possibly damaging Het
B3galt4 T A 17: 33,950,632 R211* probably null Het
Bpi T C 2: 158,274,715 I344T probably damaging Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cd207 T A 6: 83,671,775 R302W probably benign Het
Cdc5l T C 17: 45,426,516 probably null Het
Chaf1a C T 17: 56,047,540 T270I unknown Het
Col4a1 C T 8: 11,208,228 probably null Het
Col7a1 G T 9: 108,955,664 V187L unknown Het
Cry1 G A 10: 85,144,178 T422I probably benign Het
Csgalnact1 C T 8: 68,372,667 V392I probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Ddx20 G A 3: 105,679,562 T489M possibly damaging Het
Decr1 A T 4: 15,924,256 N221K probably benign Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dgka A G 10: 128,730,189 probably null Het
Dmd A T X: 83,878,557 M1478L probably benign Het
Dvl1 G A 4: 155,858,029 R584Q possibly damaging Het
Dync1li1 A T 9: 114,721,746 S450C probably damaging Het
Ehbp1l1 A G 19: 5,710,669 V1558A possibly damaging Het
Esr1 T A 10: 4,857,125 M347K probably damaging Het
F2 T A 2: 91,633,095 H148L probably benign Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fscn3 T A 6: 28,430,236 M135K possibly damaging Het
Ganab T G 19: 8,911,616 Y560* probably null Het
Garem2 T C 5: 30,108,270 V44A probably benign Het
Gja4 A G 4: 127,312,449 W174R probably damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Gm43517 A G 12: 49,389,889 probably benign Het
Gm5434 A G 12: 36,090,596 probably benign Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Kifc5b T A 17: 26,926,297 probably null Het
Kmt2b A T 7: 30,575,351 M1976K possibly damaging Het
Leng1 A T 7: 3,665,416 V11D probably damaging Het
Lrit3 A G 3: 129,800,481 V149A probably benign Het
Lrpap1 A G 5: 35,102,412 L114P probably damaging Het
Marveld3 T A 8: 109,959,748 D162V probably benign Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Myo7a A T 7: 98,054,921 V1928D probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Nexmif A G X: 104,083,953 S1453P possibly damaging Het
Nudt16l1 A G 16: 4,940,325 M182V probably benign Het
Obp2b A T 2: 25,738,551 I106L probably benign Het
Olfr1129 T A 2: 87,576,005 L307Q probably damaging Het
Olfr1239 T A 2: 89,418,411 M1L probably damaging Het
Olfr186 T A 16: 59,027,411 R165S probably damaging Het
Olfr902 T C 9: 38,449,688 I272T probably benign Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Pde7a G A 3: 19,227,799 A429V probably damaging Het
Pkd1l2 T A 8: 117,043,361 M1119L probably benign Het
Plch1 C T 3: 63,755,267 V272I probably damaging Het
Plekha4 G A 7: 45,553,906 G740D probably damaging Het
Pnliprp1 A G 19: 58,734,972 D265G possibly damaging Het
Pola1 A C X: 93,597,261 V384G probably damaging Het
Pon3 T A 6: 5,230,774 D251V probably benign Het
Pot1b A G 17: 55,674,067 C316R possibly damaging Het
Prkaca T A 8: 83,988,317 V116E probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Rasgef1c A G 11: 49,975,715 H382R possibly damaging Het
Rps25 C T 9: 44,410,008 T113I probably benign Het
Serpinb1b G T 13: 33,085,439 A52S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Siah2 C T 3: 58,676,097 R256Q probably damaging Het
Slc24a2 A G 4: 87,073,244 L404P probably damaging Het
Slc28a2 G A 2: 122,447,866 C122Y probably benign Het
Slc4a8 T C 15: 100,807,376 I821T probably damaging Het
Slc5a3 T C 16: 92,077,874 V273A possibly damaging Het
Spag7 T C 11: 70,665,018 Q61R probably benign Het
Syt7 A T 19: 10,418,038 I71F probably damaging Het
Tars2 T C 3: 95,747,454 N413S probably damaging Het
Tex14 T A 11: 87,509,621 L413Q probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Tmem131l A G 3: 83,961,544 S175P probably damaging Het
Tmem144 C T 3: 79,826,857 V180M probably benign Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmprss11g T A 5: 86,498,532 I59F probably damaging Het
Tmprss2 T A 16: 97,567,177 probably null Het
Tor1aip2 T A 1: 156,051,842 probably benign Het
Trim61 T C 8: 65,013,392 I406V possibly damaging Het
Trpv5 T C 6: 41,657,937 D486G probably damaging Het
Try5 T C 6: 41,311,769 E64G probably benign Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Ugt2b1 T C 5: 86,917,713 Y489C probably damaging Het
Ugt2b5 T A 5: 87,127,772 M407L probably benign Het
Vmn1r191 A T 13: 22,178,815 S256R possibly damaging Het
Vps13b T G 15: 35,925,408 probably null Het
Vps13d A G 4: 145,156,143 F960S probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Xaf1 A T 11: 72,306,606 D136V possibly damaging Het
Zan A G 5: 137,389,283 S4889P unknown Het
Zfp78 A G 7: 6,378,559 T203A probably benign Het
Other mutations in Zfp821
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Zfp821 APN 8 109709478 utr 5 prime probably benign
R0299:Zfp821 UTSW 8 109724230 missense probably damaging 1.00
R0685:Zfp821 UTSW 8 109724542 missense possibly damaging 0.87
R0879:Zfp821 UTSW 8 109721842 missense possibly damaging 0.95
R1743:Zfp821 UTSW 8 109724164 missense probably damaging 1.00
R2117:Zfp821 UTSW 8 109721219 missense probably damaging 1.00
R2143:Zfp821 UTSW 8 109724347 missense probably damaging 1.00
R2145:Zfp821 UTSW 8 109724347 missense probably damaging 1.00
R2402:Zfp821 UTSW 8 109721240 missense probably damaging 1.00
R2421:Zfp821 UTSW 8 109709533 splice site probably null
R4906:Zfp821 UTSW 8 109724209 missense probably damaging 1.00
R4907:Zfp821 UTSW 8 109723993 missense probably benign 0.03
R5265:Zfp821 UTSW 8 109724359 missense probably damaging 1.00
R7691:Zfp821 UTSW 8 109721239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTGATTTGTGCCCACCAAG -3'
(R):5'- AGTAGTTCTCACTCTGCTGGGG -3'

Sequencing Primer
(F):5'- TGCCCACCAAGCACTGATG -3'
(R):5'- TCACTCTGCTGGGGAGGAAG -3'
Posted On2014-08-01