Incidental Mutation 'R1956:Depdc5'
ID 217774
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 039970-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1956 (G1)
Quality Score 219
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33061175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 334 (V334A)
Ref Sequence ENSEMBL: ENSMUSP00000113980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably damaging
Transcript: ENSMUST00000049780
AA Change: V334A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: V334A

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087897
AA Change: V334A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: V334A

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119705
AA Change: V334A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: V334A

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: V334A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: V334A

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139098
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Predicted Effect probably benign
Transcript: ENSMUST00000201836
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,908,316 (GRCm39) D157V probably damaging Het
Abcg5 A G 17: 84,977,803 (GRCm39) V151A probably damaging Het
Acss3 A G 10: 106,772,029 (GRCm39) V682A probably benign Het
Adamts9 A T 6: 92,836,830 (GRCm39) C641S probably damaging Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Ankrd27 T A 7: 35,303,264 (GRCm39) Y215N probably damaging Het
Arhgef7 T A 8: 11,855,266 (GRCm39) L182Q probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Arrdc4 T C 7: 68,391,547 (GRCm39) K240R probably benign Het
Atg2b T C 12: 105,635,677 (GRCm39) Y197C probably damaging Het
Atp13a2 A G 4: 140,731,572 (GRCm39) K907R possibly damaging Het
Cadps2 A T 6: 23,287,685 (GRCm39) M1160K probably damaging Het
Cdk12 A G 11: 98,110,042 (GRCm39) T688A probably benign Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Crabp2 T C 3: 87,856,193 (GRCm39) F16L probably damaging Het
Creb3 A G 4: 43,563,279 (GRCm39) probably null Het
Crk T C 11: 75,583,496 (GRCm39) Y239H possibly damaging Het
Cyp3a13 A G 5: 137,908,204 (GRCm39) I215T probably benign Het
D130043K22Rik A G 13: 25,069,578 (GRCm39) Y879C probably damaging Het
Dgkh T C 14: 78,855,981 (GRCm39) N231S probably damaging Het
Disp2 T A 2: 118,622,704 (GRCm39) H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 (GRCm39) T563A possibly damaging Het
Ephb3 G A 16: 21,040,132 (GRCm39) R498H probably damaging Het
F10 T C 8: 13,105,422 (GRCm39) I329T probably damaging Het
Fam13b G T 18: 34,578,382 (GRCm39) Q760K possibly damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fpr-rs4 A G 17: 18,242,518 (GRCm39) Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 (GRCm39) M528K probably damaging Het
Gcc2 A G 10: 58,121,965 (GRCm39) H1134R possibly damaging Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Ggn T A 7: 28,871,341 (GRCm39) S240R probably damaging Het
Git2 C T 5: 114,887,398 (GRCm39) W299* probably null Het
Gm42669 A T 5: 107,656,738 (GRCm39) E355D possibly damaging Het
Gm5134 T C 10: 75,840,680 (GRCm39) F508S possibly damaging Het
Gm9923 G T 10: 72,145,490 (GRCm39) V114L probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Heatr5a A G 12: 51,992,202 (GRCm39) probably null Het
Hnrnpk A T 13: 58,544,000 (GRCm39) probably null Het
Ifna4 A T 4: 88,760,311 (GRCm39) I72F probably damaging Het
Ip6k3 A T 17: 27,370,142 (GRCm39) L92Q probably benign Het
Itpripl1 T C 2: 126,983,927 (GRCm39) E65G probably damaging Het
Kcnh5 G C 12: 74,944,358 (GRCm39) Q964E probably benign Het
Kmt2d A G 15: 98,757,471 (GRCm39) probably benign Het
Lrrc69 A G 4: 14,665,986 (GRCm39) V324A possibly damaging Het
Mefv T C 16: 3,535,691 (GRCm39) Q79R probably damaging Het
Mettl17 T C 14: 52,126,254 (GRCm39) S168P probably damaging Het
Mpp4 A T 1: 59,197,811 (GRCm39) S23T probably benign Het
Nabp1 A T 1: 51,517,004 (GRCm39) V24D probably damaging Het
Nod2 T A 8: 89,390,836 (GRCm39) F359Y probably damaging Het
Or10g1b C T 14: 52,628,037 (GRCm39) M64I probably benign Het
Or1p1c A T 11: 74,160,670 (GRCm39) T152S probably damaging Het
Or51b17 T G 7: 103,542,925 (GRCm39) S6R probably benign Het
Or52d3 C A 7: 104,229,116 (GRCm39) L88M probably damaging Het
Or5ak4 T C 2: 85,161,444 (GRCm39) D266G probably benign Het
Or5b107 T C 19: 13,142,560 (GRCm39) Y61H probably damaging Het
Or6a2 C T 7: 106,600,342 (GRCm39) A242T probably damaging Het
Or7a39 A G 10: 78,715,267 (GRCm39) Q87R probably benign Het
Pcdh18 T C 3: 49,710,400 (GRCm39) H305R probably benign Het
Phf1 T A 17: 27,154,719 (GRCm39) probably null Het
Pold3 T C 7: 99,737,318 (GRCm39) K379R probably benign Het
Polr1f T A 12: 33,487,817 (GRCm39) V244D probably benign Het
Pou2f3 T A 9: 43,056,534 (GRCm39) T108S probably benign Het
Prdm5 C A 6: 65,913,060 (GRCm39) T203K probably damaging Het
Psma5 A G 3: 108,173,760 (GRCm39) S79G probably benign Het
Psme4 T A 11: 30,782,424 (GRCm39) S889T probably damaging Het
Ptk2 A T 15: 73,087,832 (GRCm39) V902D possibly damaging Het
Rad54l T A 4: 115,967,554 (GRCm39) I243F probably damaging Het
Ralgapa2 A G 2: 146,302,679 (GRCm39) F95L probably benign Het
Rassf6 G A 5: 90,763,730 (GRCm39) Q71* probably null Het
Ryr2 A T 13: 11,695,966 (GRCm39) L2967H probably damaging Het
Scn5a T C 9: 119,346,479 (GRCm39) T1058A possibly damaging Het
Sdk1 T C 5: 142,080,336 (GRCm39) L1276P probably damaging Het
Serpina12 T G 12: 104,002,048 (GRCm39) T223P probably damaging Het
Sh3yl1 A G 12: 30,992,787 (GRCm39) probably null Het
Spata31g1 A T 4: 42,970,105 (GRCm39) probably null Het
St6galnac5 T A 3: 152,552,120 (GRCm39) Q149L probably benign Het
Stam2 T C 2: 52,598,239 (GRCm39) probably null Het
Tac2 A G 10: 127,564,349 (GRCm39) probably null Het
Tbata G A 10: 61,019,256 (GRCm39) D271N probably damaging Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tektl1 A G 10: 78,586,373 (GRCm39) probably null Het
Thra T A 11: 98,654,567 (GRCm39) D312E probably benign Het
Tlr1 T A 5: 65,082,520 (GRCm39) I686F probably damaging Het
Tmem86b A T 7: 4,631,706 (GRCm39) F115L probably benign Het
Tmem94 A G 11: 115,679,500 (GRCm39) D259G possibly damaging Het
Trim69 G A 2: 122,004,956 (GRCm39) probably null Het
Usp43 T A 11: 67,795,159 (GRCm39) Q243L probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn2r104 A T 17: 20,262,313 (GRCm39) N272K probably damaging Het
Vmn2r26 G A 6: 124,030,846 (GRCm39) C527Y probably damaging Het
Vmn2r84 G A 10: 130,226,677 (GRCm39) A387V probably benign Het
Vps13b A T 15: 35,869,553 (GRCm39) I2686F probably damaging Het
Vps8 C T 16: 21,279,892 (GRCm39) T281M probably damaging Het
Wdfy3 A G 5: 102,067,275 (GRCm39) V1219A probably benign Het
Wnt9b A G 11: 103,621,638 (GRCm39) C340R probably damaging Het
Zfhx3 T C 8: 109,520,774 (GRCm39) V632A probably benign Het
Zfp1006 A T 8: 129,948,309 (GRCm39) D41E possibly damaging Het
Zfp341 A T 2: 154,480,132 (GRCm39) T528S probably benign Het
Zfp990 G A 4: 145,261,452 (GRCm39) A33T probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zyx A T 6: 42,328,289 (GRCm39) K166I probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGATATCAGTGAGGGCAATTG -3'
(R):5'- CCTGGATTCCCTTGCAAAGC -3'

Sequencing Primer
(F):5'- ACTTGGTAAGATTCAGGTTGGAATG -3'
(R):5'- GCCCTCCATATTCTAAGAAGACATTG -3'
Posted On 2014-08-01