Incidental Mutation 'R1956:Rassf6'
ID217777
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 90615871 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 71 (Q71*)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000201121] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably null
Transcript: ENSMUST00000031317
AA Change: Q71*
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: Q71*

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201121
Predicted Effect probably null
Transcript: ENSMUST00000202704
AA Change: Q71*
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: Q71*

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202784
AA Change: Q71*
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: Q71*

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATGGACATGTTGAGATTGGC -3'
(R):5'- ACTAGAACTAGCTCCGAGAGGC -3'

Sequencing Primer
(F):5'- GAGATTGTCTATAATCATGCACGCAC -3'
(R):5'- GAGAGGCTGACTTTCTACTTCTTCAG -3'
Posted On2014-08-01