Incidental Mutation 'R1956:Wdfy3'
ID 217778
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission 039970-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R1956 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102067275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1219 (V1219A)
Ref Sequence ENSEMBL: ENSMUSP00000148521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: V1219A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: V1219A

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172927
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: V1219A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: V1219A

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: V1219A

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,908,316 (GRCm39) D157V probably damaging Het
Abcg5 A G 17: 84,977,803 (GRCm39) V151A probably damaging Het
Acss3 A G 10: 106,772,029 (GRCm39) V682A probably benign Het
Adamts9 A T 6: 92,836,830 (GRCm39) C641S probably damaging Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Ankrd27 T A 7: 35,303,264 (GRCm39) Y215N probably damaging Het
Arhgef7 T A 8: 11,855,266 (GRCm39) L182Q probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Arrdc4 T C 7: 68,391,547 (GRCm39) K240R probably benign Het
Atg2b T C 12: 105,635,677 (GRCm39) Y197C probably damaging Het
Atp13a2 A G 4: 140,731,572 (GRCm39) K907R possibly damaging Het
Cadps2 A T 6: 23,287,685 (GRCm39) M1160K probably damaging Het
Cdk12 A G 11: 98,110,042 (GRCm39) T688A probably benign Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Crabp2 T C 3: 87,856,193 (GRCm39) F16L probably damaging Het
Creb3 A G 4: 43,563,279 (GRCm39) probably null Het
Crk T C 11: 75,583,496 (GRCm39) Y239H possibly damaging Het
Cyp3a13 A G 5: 137,908,204 (GRCm39) I215T probably benign Het
D130043K22Rik A G 13: 25,069,578 (GRCm39) Y879C probably damaging Het
Depdc5 T C 5: 33,061,175 (GRCm39) V334A probably damaging Het
Dgkh T C 14: 78,855,981 (GRCm39) N231S probably damaging Het
Disp2 T A 2: 118,622,704 (GRCm39) H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 (GRCm39) T563A possibly damaging Het
Ephb3 G A 16: 21,040,132 (GRCm39) R498H probably damaging Het
F10 T C 8: 13,105,422 (GRCm39) I329T probably damaging Het
Fam13b G T 18: 34,578,382 (GRCm39) Q760K possibly damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fpr-rs4 A G 17: 18,242,518 (GRCm39) Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 (GRCm39) M528K probably damaging Het
Gcc2 A G 10: 58,121,965 (GRCm39) H1134R possibly damaging Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Ggn T A 7: 28,871,341 (GRCm39) S240R probably damaging Het
Git2 C T 5: 114,887,398 (GRCm39) W299* probably null Het
Gm42669 A T 5: 107,656,738 (GRCm39) E355D possibly damaging Het
Gm5134 T C 10: 75,840,680 (GRCm39) F508S possibly damaging Het
Gm9923 G T 10: 72,145,490 (GRCm39) V114L probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Heatr5a A G 12: 51,992,202 (GRCm39) probably null Het
Hnrnpk A T 13: 58,544,000 (GRCm39) probably null Het
Ifna4 A T 4: 88,760,311 (GRCm39) I72F probably damaging Het
Ip6k3 A T 17: 27,370,142 (GRCm39) L92Q probably benign Het
Itpripl1 T C 2: 126,983,927 (GRCm39) E65G probably damaging Het
Kcnh5 G C 12: 74,944,358 (GRCm39) Q964E probably benign Het
Kmt2d A G 15: 98,757,471 (GRCm39) probably benign Het
Lrrc69 A G 4: 14,665,986 (GRCm39) V324A possibly damaging Het
Mefv T C 16: 3,535,691 (GRCm39) Q79R probably damaging Het
Mettl17 T C 14: 52,126,254 (GRCm39) S168P probably damaging Het
Mpp4 A T 1: 59,197,811 (GRCm39) S23T probably benign Het
Nabp1 A T 1: 51,517,004 (GRCm39) V24D probably damaging Het
Nod2 T A 8: 89,390,836 (GRCm39) F359Y probably damaging Het
Or10g1b C T 14: 52,628,037 (GRCm39) M64I probably benign Het
Or1p1c A T 11: 74,160,670 (GRCm39) T152S probably damaging Het
Or51b17 T G 7: 103,542,925 (GRCm39) S6R probably benign Het
Or52d3 C A 7: 104,229,116 (GRCm39) L88M probably damaging Het
Or5ak4 T C 2: 85,161,444 (GRCm39) D266G probably benign Het
Or5b107 T C 19: 13,142,560 (GRCm39) Y61H probably damaging Het
Or6a2 C T 7: 106,600,342 (GRCm39) A242T probably damaging Het
Or7a39 A G 10: 78,715,267 (GRCm39) Q87R probably benign Het
Pcdh18 T C 3: 49,710,400 (GRCm39) H305R probably benign Het
Phf1 T A 17: 27,154,719 (GRCm39) probably null Het
Pold3 T C 7: 99,737,318 (GRCm39) K379R probably benign Het
Polr1f T A 12: 33,487,817 (GRCm39) V244D probably benign Het
Pou2f3 T A 9: 43,056,534 (GRCm39) T108S probably benign Het
Prdm5 C A 6: 65,913,060 (GRCm39) T203K probably damaging Het
Psma5 A G 3: 108,173,760 (GRCm39) S79G probably benign Het
Psme4 T A 11: 30,782,424 (GRCm39) S889T probably damaging Het
Ptk2 A T 15: 73,087,832 (GRCm39) V902D possibly damaging Het
Rad54l T A 4: 115,967,554 (GRCm39) I243F probably damaging Het
Ralgapa2 A G 2: 146,302,679 (GRCm39) F95L probably benign Het
Rassf6 G A 5: 90,763,730 (GRCm39) Q71* probably null Het
Ryr2 A T 13: 11,695,966 (GRCm39) L2967H probably damaging Het
Scn5a T C 9: 119,346,479 (GRCm39) T1058A possibly damaging Het
Sdk1 T C 5: 142,080,336 (GRCm39) L1276P probably damaging Het
Serpina12 T G 12: 104,002,048 (GRCm39) T223P probably damaging Het
Sh3yl1 A G 12: 30,992,787 (GRCm39) probably null Het
Spata31g1 A T 4: 42,970,105 (GRCm39) probably null Het
St6galnac5 T A 3: 152,552,120 (GRCm39) Q149L probably benign Het
Stam2 T C 2: 52,598,239 (GRCm39) probably null Het
Tac2 A G 10: 127,564,349 (GRCm39) probably null Het
Tbata G A 10: 61,019,256 (GRCm39) D271N probably damaging Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tektl1 A G 10: 78,586,373 (GRCm39) probably null Het
Thra T A 11: 98,654,567 (GRCm39) D312E probably benign Het
Tlr1 T A 5: 65,082,520 (GRCm39) I686F probably damaging Het
Tmem86b A T 7: 4,631,706 (GRCm39) F115L probably benign Het
Tmem94 A G 11: 115,679,500 (GRCm39) D259G possibly damaging Het
Trim69 G A 2: 122,004,956 (GRCm39) probably null Het
Usp43 T A 11: 67,795,159 (GRCm39) Q243L probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn2r104 A T 17: 20,262,313 (GRCm39) N272K probably damaging Het
Vmn2r26 G A 6: 124,030,846 (GRCm39) C527Y probably damaging Het
Vmn2r84 G A 10: 130,226,677 (GRCm39) A387V probably benign Het
Vps13b A T 15: 35,869,553 (GRCm39) I2686F probably damaging Het
Vps8 C T 16: 21,279,892 (GRCm39) T281M probably damaging Het
Wnt9b A G 11: 103,621,638 (GRCm39) C340R probably damaging Het
Zfhx3 T C 8: 109,520,774 (GRCm39) V632A probably benign Het
Zfp1006 A T 8: 129,948,309 (GRCm39) D41E possibly damaging Het
Zfp341 A T 2: 154,480,132 (GRCm39) T528S probably benign Het
Zfp990 G A 4: 145,261,452 (GRCm39) A33T probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zyx A T 6: 42,328,289 (GRCm39) K166I probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 102,105,309 (GRCm39) missense probably benign 0.13
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101,991,947 (GRCm39) missense probably benign
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 102,032,004 (GRCm39) missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7543:Wdfy3 UTSW 5 102,083,925 (GRCm39) missense probably benign 0.00
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 102,078,830 (GRCm39) missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGTGGAGTTCTCCATGAATGC -3'
(R):5'- GATCTAGAAATCTGTGATCCAGCAC -3'

Sequencing Primer
(F):5'- GTGGAGTTCTCCATGAATGCTCATC -3'
(R):5'- TGTGATCCAGCACAGGGAC -3'
Posted On 2014-08-01