Incidental Mutation 'R1956:Git2'
ID217780
Institutional Source Beutler Lab
Gene Symbol Git2
Ensembl Gene ENSMUSG00000041890
Gene NameG protein-coupled receptor kinase-interactor 2
Synonyms5830420E16Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 9630056M03Rik, B230104M05Rik, 1500036H07Rik, Cat-2
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114727407-114775517 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 114749337 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 299 (W299*)
Ref Sequence ENSEMBL: ENSMUSP00000136796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043283] [ENSMUST00000086564] [ENSMUST00000112183] [ENSMUST00000112185] [ENSMUST00000131993] [ENSMUST00000155908] [ENSMUST00000178440]
Predicted Effect probably null
Transcript: ENSMUST00000043283
AA Change: W298*
SMART Domains Protein: ENSMUSP00000039718
Gene: ENSMUSG00000041890
AA Change: W298*

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT1_C 550 674 2.4e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086564
AA Change: W298*
SMART Domains Protein: ENSMUSP00000083754
Gene: ENSMUSG00000041890
AA Change: W298*

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT_CC 414 478 3.7e-31 PFAM
low complexity region 555 570 N/A INTRINSIC
Pfam:GIT1_C 636 752 6.4e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112183
AA Change: W300*
SMART Domains Protein: ENSMUSP00000107801
Gene: ENSMUSG00000041890
AA Change: W300*

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 268 298 4.96e-10 SMART
GIT 332 362 1.27e-7 SMART
Pfam:GIT1_C 552 676 1e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112185
AA Change: W297*
SMART Domains Protein: ENSMUSP00000107803
Gene: ENSMUSG00000041890
AA Change: W297*

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 265 295 4.96e-10 SMART
GIT 329 359 1.27e-7 SMART
low complexity region 504 519 N/A INTRINSIC
Pfam:GIT1_C 579 703 3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130925
SMART Domains Protein: ENSMUSP00000115185
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
Pfam:GIT_SHD 1 21 9.7e-5 PFAM
Pfam:GIT_CC 77 115 7.7e-14 PFAM
low complexity region 203 218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131993
AA Change: W188*
SMART Domains Protein: ENSMUSP00000118812
Gene: ENSMUSG00000041890
AA Change: W188*

DomainStartEndE-ValueType
ANK 21 50 2.55e2 SMART
ANK 55 84 1.21e1 SMART
ANK 88 117 3.95e1 SMART
Pfam:GIT_SHD 156 186 7.9e-19 PFAM
Pfam:GIT_SHD 220 249 3.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153756
Predicted Effect probably null
Transcript: ENSMUST00000155908
AA Change: W298*
SMART Domains Protein: ENSMUSP00000122302
Gene: ENSMUSG00000041890
AA Change: W298*

DomainStartEndE-ValueType
ArfGap 1 96 2.04e-25 SMART
ANK 104 133 2.55e2 SMART
ANK 138 167 1.21e1 SMART
ANK 171 200 3.95e1 SMART
GIT 238 268 4.96e-10 SMART
GIT 302 332 1.27e-7 SMART
Pfam:GIT1_C 474 598 8.3e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178440
AA Change: W299*
SMART Domains Protein: ENSMUSP00000136796
Gene: ENSMUSG00000041890
AA Change: W299*

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 267 297 4.96e-10 SMART
GIT 331 361 1.27e-7 SMART
Pfam:GIT1_C 551 675 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202581
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele show frequent splenomegaly, extramedullary hematopoiesis, impaired neutrophil chemotaxis, misoriented hyperproduction of superoxide anions and increased susceptibility to fungal infection. Homozygotes for a gene trap allele have reduced marginal zone B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Git2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Git2 APN 5 114767105 missense probably damaging 1.00
IGL02538:Git2 APN 5 114730986 splice site probably benign
IGL03114:Git2 APN 5 114733857 splice site probably benign
IGL03278:Git2 APN 5 114745579 splice site probably benign
IGL03278:Git2 APN 5 114745580 splice site probably null
ponto UTSW 5 114739101 missense probably damaging 1.00
vecchio UTSW 5 114769698 nonsense probably null
R0184:Git2 UTSW 5 114739037 missense possibly damaging 0.47
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0540:Git2 UTSW 5 114748274 missense probably damaging 1.00
R0543:Git2 UTSW 5 114745531 missense probably damaging 0.97
R0612:Git2 UTSW 5 114752281 missense probably damaging 1.00
R1144:Git2 UTSW 5 114753314 missense probably benign 0.27
R1225:Git2 UTSW 5 114733178 splice site probably benign
R1783:Git2 UTSW 5 114739124 missense probably damaging 1.00
R1923:Git2 UTSW 5 114739101 missense probably damaging 1.00
R1981:Git2 UTSW 5 114749559 splice site probably benign
R2029:Git2 UTSW 5 114766450 critical splice donor site probably null
R3150:Git2 UTSW 5 114730349 missense probably damaging 1.00
R4087:Git2 UTSW 5 114764405 missense probably damaging 0.99
R4367:Git2 UTSW 5 114764666 missense probably damaging 1.00
R4400:Git2 UTSW 5 114733909 missense possibly damaging 0.94
R4702:Git2 UTSW 5 114745482 missense probably damaging 1.00
R4758:Git2 UTSW 5 114730351 missense probably damaging 1.00
R4840:Git2 UTSW 5 114745482 missense probably damaging 1.00
R5236:Git2 UTSW 5 114767172 missense probably damaging 1.00
R5427:Git2 UTSW 5 114730328 missense possibly damaging 0.82
R5510:Git2 UTSW 5 114743774 critical splice donor site probably null
R6014:Git2 UTSW 5 114733877 missense probably benign 0.32
R6162:Git2 UTSW 5 114761656 missense probably damaging 0.99
R6195:Git2 UTSW 5 114767114 missense probably benign 0.27
R6198:Git2 UTSW 5 114745495 nonsense probably null
R6233:Git2 UTSW 5 114767114 missense probably benign 0.27
R6277:Git2 UTSW 5 114733247 missense probably damaging 1.00
R6603:Git2 UTSW 5 114730991 critical splice donor site probably null
R7141:Git2 UTSW 5 114769698 nonsense probably null
R7420:Git2 UTSW 5 114730370 missense probably benign 0.00
R7468:Git2 UTSW 5 114733897 missense probably damaging 1.00
R7574:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7575:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7577:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7651:Git2 UTSW 5 114733235 missense probably damaging 1.00
R7658:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7893:Git2 UTSW 5 114769676 missense possibly damaging 0.83
R7976:Git2 UTSW 5 114769676 missense possibly damaging 0.83
R8067:Git2 UTSW 5 114766518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCGTGTATGTCCACAAGG -3'
(R):5'- TACGACGAAGTTGACAGGCG -3'

Sequencing Primer
(F):5'- GGACACCAAATATCATGCCATCAGTC -3'
(R):5'- TAGCATGCGGCCTACCTAC -3'
Posted On2014-08-01