Incidental Mutation 'R1956:Sdk1'
ID217783
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142094581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1276 (L1276P)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably damaging
Transcript: ENSMUST00000074546
AA Change: L1016P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: L1016P

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085774
AA Change: L1276P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: L1276P

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense probably null 0.58
Z1177:Sdk1 UTSW 5 141962708 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCATGAGTATGGTGTGTATATGCAC -3'
(R):5'- TTTGCCTCCTGACTGATGGC -3'

Sequencing Primer
(F):5'- ACATGTGTATGATATGTATGTGTGC -3'
(R):5'- TGATGGCCAGAAAACACTTCTCCTAG -3'
Posted On2014-08-01