Incidental Mutation 'R1956:Cadps2'
ID 217784
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 039970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1956 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23287685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1160 (M1160K)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: M1205K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: M1205K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: M1198K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: M1198K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: M1165K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: M1165K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: M1160K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: M1160K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
AA Change: M800K

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: M800K

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: M1176K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: M1176K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: M1205K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: M1205K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: M1176K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: M1176K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,908,316 (GRCm39) D157V probably damaging Het
Abcg5 A G 17: 84,977,803 (GRCm39) V151A probably damaging Het
Acss3 A G 10: 106,772,029 (GRCm39) V682A probably benign Het
Adamts9 A T 6: 92,836,830 (GRCm39) C641S probably damaging Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Ankrd27 T A 7: 35,303,264 (GRCm39) Y215N probably damaging Het
Arhgef7 T A 8: 11,855,266 (GRCm39) L182Q probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Arrdc4 T C 7: 68,391,547 (GRCm39) K240R probably benign Het
Atg2b T C 12: 105,635,677 (GRCm39) Y197C probably damaging Het
Atp13a2 A G 4: 140,731,572 (GRCm39) K907R possibly damaging Het
Cdk12 A G 11: 98,110,042 (GRCm39) T688A probably benign Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Crabp2 T C 3: 87,856,193 (GRCm39) F16L probably damaging Het
Creb3 A G 4: 43,563,279 (GRCm39) probably null Het
Crk T C 11: 75,583,496 (GRCm39) Y239H possibly damaging Het
Cyp3a13 A G 5: 137,908,204 (GRCm39) I215T probably benign Het
D130043K22Rik A G 13: 25,069,578 (GRCm39) Y879C probably damaging Het
Depdc5 T C 5: 33,061,175 (GRCm39) V334A probably damaging Het
Dgkh T C 14: 78,855,981 (GRCm39) N231S probably damaging Het
Disp2 T A 2: 118,622,704 (GRCm39) H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 (GRCm39) T563A possibly damaging Het
Ephb3 G A 16: 21,040,132 (GRCm39) R498H probably damaging Het
F10 T C 8: 13,105,422 (GRCm39) I329T probably damaging Het
Fam13b G T 18: 34,578,382 (GRCm39) Q760K possibly damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fpr-rs4 A G 17: 18,242,518 (GRCm39) Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 (GRCm39) M528K probably damaging Het
Gcc2 A G 10: 58,121,965 (GRCm39) H1134R possibly damaging Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Ggn T A 7: 28,871,341 (GRCm39) S240R probably damaging Het
Git2 C T 5: 114,887,398 (GRCm39) W299* probably null Het
Gm42669 A T 5: 107,656,738 (GRCm39) E355D possibly damaging Het
Gm5134 T C 10: 75,840,680 (GRCm39) F508S possibly damaging Het
Gm9923 G T 10: 72,145,490 (GRCm39) V114L probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Heatr5a A G 12: 51,992,202 (GRCm39) probably null Het
Hnrnpk A T 13: 58,544,000 (GRCm39) probably null Het
Ifna4 A T 4: 88,760,311 (GRCm39) I72F probably damaging Het
Ip6k3 A T 17: 27,370,142 (GRCm39) L92Q probably benign Het
Itpripl1 T C 2: 126,983,927 (GRCm39) E65G probably damaging Het
Kcnh5 G C 12: 74,944,358 (GRCm39) Q964E probably benign Het
Kmt2d A G 15: 98,757,471 (GRCm39) probably benign Het
Lrrc69 A G 4: 14,665,986 (GRCm39) V324A possibly damaging Het
Mefv T C 16: 3,535,691 (GRCm39) Q79R probably damaging Het
Mettl17 T C 14: 52,126,254 (GRCm39) S168P probably damaging Het
Mpp4 A T 1: 59,197,811 (GRCm39) S23T probably benign Het
Nabp1 A T 1: 51,517,004 (GRCm39) V24D probably damaging Het
Nod2 T A 8: 89,390,836 (GRCm39) F359Y probably damaging Het
Or10g1b C T 14: 52,628,037 (GRCm39) M64I probably benign Het
Or1p1c A T 11: 74,160,670 (GRCm39) T152S probably damaging Het
Or51b17 T G 7: 103,542,925 (GRCm39) S6R probably benign Het
Or52d3 C A 7: 104,229,116 (GRCm39) L88M probably damaging Het
Or5ak4 T C 2: 85,161,444 (GRCm39) D266G probably benign Het
Or5b107 T C 19: 13,142,560 (GRCm39) Y61H probably damaging Het
Or6a2 C T 7: 106,600,342 (GRCm39) A242T probably damaging Het
Or7a39 A G 10: 78,715,267 (GRCm39) Q87R probably benign Het
Pcdh18 T C 3: 49,710,400 (GRCm39) H305R probably benign Het
Phf1 T A 17: 27,154,719 (GRCm39) probably null Het
Pold3 T C 7: 99,737,318 (GRCm39) K379R probably benign Het
Polr1f T A 12: 33,487,817 (GRCm39) V244D probably benign Het
Pou2f3 T A 9: 43,056,534 (GRCm39) T108S probably benign Het
Prdm5 C A 6: 65,913,060 (GRCm39) T203K probably damaging Het
Psma5 A G 3: 108,173,760 (GRCm39) S79G probably benign Het
Psme4 T A 11: 30,782,424 (GRCm39) S889T probably damaging Het
Ptk2 A T 15: 73,087,832 (GRCm39) V902D possibly damaging Het
Rad54l T A 4: 115,967,554 (GRCm39) I243F probably damaging Het
Ralgapa2 A G 2: 146,302,679 (GRCm39) F95L probably benign Het
Rassf6 G A 5: 90,763,730 (GRCm39) Q71* probably null Het
Ryr2 A T 13: 11,695,966 (GRCm39) L2967H probably damaging Het
Scn5a T C 9: 119,346,479 (GRCm39) T1058A possibly damaging Het
Sdk1 T C 5: 142,080,336 (GRCm39) L1276P probably damaging Het
Serpina12 T G 12: 104,002,048 (GRCm39) T223P probably damaging Het
Sh3yl1 A G 12: 30,992,787 (GRCm39) probably null Het
Spata31g1 A T 4: 42,970,105 (GRCm39) probably null Het
St6galnac5 T A 3: 152,552,120 (GRCm39) Q149L probably benign Het
Stam2 T C 2: 52,598,239 (GRCm39) probably null Het
Tac2 A G 10: 127,564,349 (GRCm39) probably null Het
Tbata G A 10: 61,019,256 (GRCm39) D271N probably damaging Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tektl1 A G 10: 78,586,373 (GRCm39) probably null Het
Thra T A 11: 98,654,567 (GRCm39) D312E probably benign Het
Tlr1 T A 5: 65,082,520 (GRCm39) I686F probably damaging Het
Tmem86b A T 7: 4,631,706 (GRCm39) F115L probably benign Het
Tmem94 A G 11: 115,679,500 (GRCm39) D259G possibly damaging Het
Trim69 G A 2: 122,004,956 (GRCm39) probably null Het
Usp43 T A 11: 67,795,159 (GRCm39) Q243L probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn2r104 A T 17: 20,262,313 (GRCm39) N272K probably damaging Het
Vmn2r26 G A 6: 124,030,846 (GRCm39) C527Y probably damaging Het
Vmn2r84 G A 10: 130,226,677 (GRCm39) A387V probably benign Het
Vps13b A T 15: 35,869,553 (GRCm39) I2686F probably damaging Het
Vps8 C T 16: 21,279,892 (GRCm39) T281M probably damaging Het
Wdfy3 A G 5: 102,067,275 (GRCm39) V1219A probably benign Het
Wnt9b A G 11: 103,621,638 (GRCm39) C340R probably damaging Het
Zfhx3 T C 8: 109,520,774 (GRCm39) V632A probably benign Het
Zfp1006 A T 8: 129,948,309 (GRCm39) D41E possibly damaging Het
Zfp341 A T 2: 154,480,132 (GRCm39) T528S probably benign Het
Zfp990 G A 4: 145,261,452 (GRCm39) A33T probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zyx A T 6: 42,328,289 (GRCm39) K166I probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGTTACGAGTGATGGACAACAC -3'
(R):5'- GGGTGAACAATTCCAACAGC -3'

Sequencing Primer
(F):5'- GACAACACTGATATTAAGTCAAGTGC -3'
(R):5'- TCCAACAGCTATGAAAATGATTTCC -3'
Posted On 2014-08-01