Incidental Mutation 'R1956:Pou2f3'
ID217808
Institutional Source Beutler Lab
Gene Symbol Pou2f3
Ensembl Gene ENSMUSG00000032015
Gene NamePOU domain, class 2, transcription factor 3
SynonymsOtf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location43123939-43210369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43145237 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 108 (T108S)
Ref Sequence ENSEMBL: ENSMUSP00000135115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]
Predicted Effect probably benign
Transcript: ENSMUST00000034513
AA Change: T96S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: T96S

DomainStartEndE-ValueType
low complexity region 107 122 N/A INTRINSIC
low complexity region 150 162 N/A INTRINSIC
POU 164 238 1.47e-53 SMART
low complexity region 239 256 N/A INTRINSIC
HOX 262 324 8.39e-20 SMART
low complexity region 337 352 N/A INTRINSIC
low complexity region 362 378 N/A INTRINSIC
low complexity region 386 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176636
AA Change: T108S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: T108S

DomainStartEndE-ValueType
low complexity region 119 134 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
POU 176 250 1.47e-53 SMART
low complexity region 251 268 N/A INTRINSIC
HOX 274 336 8.39e-20 SMART
low complexity region 349 364 N/A INTRINSIC
low complexity region 374 390 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213862
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Pou2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pou2f3 APN 9 43128893 missense probably damaging 1.00
IGL00508:Pou2f3 APN 9 43139963 missense probably benign 0.01
IGL00975:Pou2f3 APN 9 43137384 missense probably benign
IGL01577:Pou2f3 APN 9 43146881 nonsense probably null
IGL01871:Pou2f3 APN 9 43134473 splice site probably benign
IGL02370:Pou2f3 APN 9 43137348 missense probably damaging 1.00
IGL02674:Pou2f3 APN 9 43139333 missense probably damaging 1.00
IGL02746:Pou2f3 APN 9 43146846 missense probably benign 0.01
IGL02956:Pou2f3 APN 9 43142805 splice site probably benign
IGL02962:Pou2f3 APN 9 43125089 utr 3 prime probably benign
IGL03082:Pou2f3 APN 9 43146915 critical splice acceptor site probably null
R0433:Pou2f3 UTSW 9 43127398 missense probably benign 0.23
R0622:Pou2f3 UTSW 9 43125119 missense probably damaging 1.00
R0926:Pou2f3 UTSW 9 43146901 missense probably damaging 1.00
R4782:Pou2f3 UTSW 9 43139858 missense probably damaging 0.97
R4877:Pou2f3 UTSW 9 43139323 missense possibly damaging 0.58
R5070:Pou2f3 UTSW 9 43145281 missense possibly damaging 0.52
R5910:Pou2f3 UTSW 9 43134474 splice site probably null
R6280:Pou2f3 UTSW 9 43139339 missense probably damaging 1.00
R6280:Pou2f3 UTSW 9 43139340 missense probably damaging 1.00
R6465:Pou2f3 UTSW 9 43139867 missense probably damaging 1.00
R7084:Pou2f3 UTSW 9 43128893 missense probably damaging 1.00
R7161:Pou2f3 UTSW 9 43139363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAACACTGGATGGTCTG -3'
(R):5'- TTGCAGCCCCAGGGACTATATG -3'

Sequencing Primer
(F):5'- CTATGTCTCAGGCACAGAAGCTG -3'
(R):5'- CTATATGAGTCGTAGCCCAGCAG -3'
Posted On2014-08-01