Mutagenetix > Incidental Mutation

Incidental Mutation 'R1956:Pou2f3'

217808

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

039970-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1956 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43145237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 108 (T108S)

Ref Sequence

ENSEMBL: ENSMUSP00000135115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034513
AA Change: T96S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: T96S

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176636
AA Change: T108S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: T108S

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,970,105		probably null	Het
2610044O15Rik8	A	T	8: 129,221,828	D41E	possibly damaging	Het
Aard	A	T	15: 52,044,920	D157V	probably damaging	Het
Abcg5	A	G	17: 84,670,375	V151A	probably damaging	Het
Acss3	A	G	10: 106,936,168	V682A	probably benign	Het
Adamts9	A	T	6: 92,859,849	C641S	probably damaging	Het
Adipor1	T	C	1: 134,423,033	S7P	probably benign	Het
Ankrd27	T	A	7: 35,603,839	Y215N	probably damaging	Het
Arhgef7	T	A	8: 11,805,266	L182Q	probably damaging	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
Arrdc4	T	C	7: 68,741,799	K240R	probably benign	Het
Atg2b	T	C	12: 105,669,418	Y197C	probably damaging	Het
Atp13a2	A	G	4: 141,004,261	K907R	possibly damaging	Het
Cadps2	A	T	6: 23,287,686	M1160K	probably damaging	Het
Ccdc105	A	G	10: 78,750,539		probably null	Het
Cdk12	A	G	11: 98,219,216	T688A	probably benign	Het
Cfap43	T	A	19: 47,897,210	Y322F	probably benign	Het
Crabp2	T	C	3: 87,948,886	F16L	probably damaging	Het
Creb3	A	G	4: 43,563,279		probably null	Het
Crk	T	C	11: 75,692,670	Y239H	possibly damaging	Het
Cyp3a13	A	G	5: 137,909,942	I215T	probably benign	Het
D130043K22Rik	A	G	13: 24,885,595	Y879C	probably damaging	Het
Depdc5	T	C	5: 32,903,831	V334A	probably damaging	Het
Dgkh	T	C	14: 78,618,541	N231S	probably damaging	Het
Disp2	T	A	2: 118,792,223	H1145Q	probably benign	Het
Epb41l4b	T	C	4: 57,038,553	T563A	possibly damaging	Het
Ephb3	G	A	16: 21,221,382	R498H	probably damaging	Het
F10	T	C	8: 13,055,422	I329T	probably damaging	Het
Fam13b	G	T	18: 34,445,329	Q760K	possibly damaging	Het
Fmo4	G	A	1: 162,803,690	T236I	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Fpr-rs4	A	G	17: 18,022,256	Y175C	probably damaging	Het
Fzd8	T	A	18: 9,214,502	M528K	probably damaging	Het
Gcc2	A	G	10: 58,286,143	H1134R	possibly damaging	Het
Gdf10	G	A	14: 33,932,753	A406T	probably benign	Het
Ggn	T	A	7: 29,171,916	S240R	probably damaging	Het
Git2	C	T	5: 114,749,337	W299*	probably null	Het
Gm42669	A	T	5: 107,508,872	E355D	possibly damaging	Het
Gm5134	T	C	10: 76,004,846	F508S	possibly damaging	Het
Gm9923	G	T	10: 72,309,660	V114L	probably benign	Het
Has3	A	T	8: 106,878,803	Y547F	probably benign	Het
Heatr5a	A	G	12: 51,945,419		probably null	Het
Hnrnpk	A	T	13: 58,396,186		probably null	Het
Ifna4	A	T	4: 88,842,074	I72F	probably damaging	Het
Ip6k3	A	T	17: 27,151,168	L92Q	probably benign	Het
Itpripl1	T	C	2: 127,142,007	E65G	probably damaging	Het
Kcnh5	G	C	12: 74,897,584	Q964E	probably benign	Het
Kmt2d	A	G	15: 98,859,590		probably benign	Het
Lrrc69	A	G	4: 14,665,986	V324A	possibly damaging	Het
Mefv	T	C	16: 3,717,827	Q79R	probably damaging	Het
Mettl17	T	C	14: 51,888,797	S168P	probably damaging	Het
Mpp4	A	T	1: 59,158,652	S23T	probably benign	Het
Nabp1	A	T	1: 51,477,845	V24D	probably damaging	Het
Nod2	T	A	8: 88,664,208	F359Y	probably damaging	Het
Olfr1355	A	G	10: 78,879,433	Q87R	probably benign	Het
Olfr1461	T	C	19: 13,165,196	Y61H	probably damaging	Het
Olfr1511	C	T	14: 52,390,580	M64I	probably benign	Het
Olfr2	C	T	7: 107,001,135	A242T	probably damaging	Het
Olfr406	A	T	11: 74,269,844	T152S	probably damaging	Het
Olfr64	T	G	7: 103,893,718	S6R	probably benign	Het
Olfr653	C	A	7: 104,579,909	L88M	probably damaging	Het
Olfr987	T	C	2: 85,331,100	D266G	probably benign	Het
Pcdh18	T	C	3: 49,755,951	H305R	probably benign	Het
Phf1	T	A	17: 26,935,745		probably null	Het
Pold3	T	C	7: 100,088,111	K379R	probably benign	Het
Prdm5	C	A	6: 65,936,076	T203K	probably damaging	Het
Psma5	A	G	3: 108,266,444	S79G	probably benign	Het
Psme4	T	A	11: 30,832,424	S889T	probably damaging	Het
Ptk2	A	T	15: 73,215,983	V902D	possibly damaging	Het
Rad54l	T	A	4: 116,110,357	I243F	probably damaging	Het
Ralgapa2	A	G	2: 146,460,759	F95L	probably benign	Het
Rassf6	G	A	5: 90,615,871	Q71*	probably null	Het
Ryr2	A	T	13: 11,681,080	L2967H	probably damaging	Het
Scn5a	T	C	9: 119,517,413	T1058A	possibly damaging	Het
Sdk1	T	C	5: 142,094,581	L1276P	probably damaging	Het
Serpina12	T	G	12: 104,035,789	T223P	probably damaging	Het
Sh3yl1	A	G	12: 30,942,788		probably null	Het
St6galnac5	T	A	3: 152,846,483	Q149L	probably benign	Het
Stam2	T	C	2: 52,708,227		probably null	Het
Tac2	A	G	10: 127,728,480		probably null	Het
Tbata	G	A	10: 61,183,477	D271N	probably damaging	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Thra	T	A	11: 98,763,741	D312E	probably benign	Het
Tlr1	T	A	5: 64,925,177	I686F	probably damaging	Het
Tmem86b	A	T	7: 4,628,707	F115L	probably benign	Het
Tmem94	A	G	11: 115,788,674	D259G	possibly damaging	Het
Trim69	G	A	2: 122,174,475		probably null	Het
Twistnb	T	A	12: 33,437,818	V244D	probably benign	Het
Usp43	T	A	11: 67,904,333	Q243L	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn2r104	A	T	17: 20,042,051	N272K	probably damaging	Het
Vmn2r26	G	A	6: 124,053,887	C527Y	probably damaging	Het
Vmn2r84	G	A	10: 130,390,808	A387V	probably benign	Het
Vps13b	A	T	15: 35,869,407	I2686F	probably damaging	Het
Vps8	C	T	16: 21,461,142	T281M	probably damaging	Het
Wdfy3	A	G	5: 101,919,409	V1219A	probably benign	Het
Wnt9b	A	G	11: 103,730,812	C340R	probably damaging	Het
Zfhx3	T	C	8: 108,794,142	V632A	probably benign	Het
Zfp341	A	T	2: 154,638,212	T528S	probably benign	Het
Zfp990	G	A	4: 145,534,882	A33T	probably damaging	Het
Zranb1	T	G	7: 132,982,729	S601R	probably damaging	Het
Zyx	A	T	6: 42,351,355	K166I	probably damaging	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGAACACTGGATGGTCTG -3'
(R):5'- TTGCAGCCCCAGGGACTATATG -3'

Sequencing Primer
(F):5'- CTATGTCTCAGGCACAGAAGCTG -3'
(R):5'- CTATATGAGTCGTAGCCCAGCAG -3'

Posted On

2014-08-01