Incidental Mutation 'R1956:Psme4'
ID 217819
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 039970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1956 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30782424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 889 (S889T)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: S889T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: S889T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150219
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,908,316 (GRCm39) D157V probably damaging Het
Abcg5 A G 17: 84,977,803 (GRCm39) V151A probably damaging Het
Acss3 A G 10: 106,772,029 (GRCm39) V682A probably benign Het
Adamts9 A T 6: 92,836,830 (GRCm39) C641S probably damaging Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Ankrd27 T A 7: 35,303,264 (GRCm39) Y215N probably damaging Het
Arhgef7 T A 8: 11,855,266 (GRCm39) L182Q probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Arrdc4 T C 7: 68,391,547 (GRCm39) K240R probably benign Het
Atg2b T C 12: 105,635,677 (GRCm39) Y197C probably damaging Het
Atp13a2 A G 4: 140,731,572 (GRCm39) K907R possibly damaging Het
Cadps2 A T 6: 23,287,685 (GRCm39) M1160K probably damaging Het
Cdk12 A G 11: 98,110,042 (GRCm39) T688A probably benign Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Crabp2 T C 3: 87,856,193 (GRCm39) F16L probably damaging Het
Creb3 A G 4: 43,563,279 (GRCm39) probably null Het
Crk T C 11: 75,583,496 (GRCm39) Y239H possibly damaging Het
Cyp3a13 A G 5: 137,908,204 (GRCm39) I215T probably benign Het
D130043K22Rik A G 13: 25,069,578 (GRCm39) Y879C probably damaging Het
Depdc5 T C 5: 33,061,175 (GRCm39) V334A probably damaging Het
Dgkh T C 14: 78,855,981 (GRCm39) N231S probably damaging Het
Disp2 T A 2: 118,622,704 (GRCm39) H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 (GRCm39) T563A possibly damaging Het
Ephb3 G A 16: 21,040,132 (GRCm39) R498H probably damaging Het
F10 T C 8: 13,105,422 (GRCm39) I329T probably damaging Het
Fam13b G T 18: 34,578,382 (GRCm39) Q760K possibly damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fpr-rs4 A G 17: 18,242,518 (GRCm39) Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 (GRCm39) M528K probably damaging Het
Gcc2 A G 10: 58,121,965 (GRCm39) H1134R possibly damaging Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Ggn T A 7: 28,871,341 (GRCm39) S240R probably damaging Het
Git2 C T 5: 114,887,398 (GRCm39) W299* probably null Het
Gm42669 A T 5: 107,656,738 (GRCm39) E355D possibly damaging Het
Gm5134 T C 10: 75,840,680 (GRCm39) F508S possibly damaging Het
Gm9923 G T 10: 72,145,490 (GRCm39) V114L probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Heatr5a A G 12: 51,992,202 (GRCm39) probably null Het
Hnrnpk A T 13: 58,544,000 (GRCm39) probably null Het
Ifna4 A T 4: 88,760,311 (GRCm39) I72F probably damaging Het
Ip6k3 A T 17: 27,370,142 (GRCm39) L92Q probably benign Het
Itpripl1 T C 2: 126,983,927 (GRCm39) E65G probably damaging Het
Kcnh5 G C 12: 74,944,358 (GRCm39) Q964E probably benign Het
Kmt2d A G 15: 98,757,471 (GRCm39) probably benign Het
Lrrc69 A G 4: 14,665,986 (GRCm39) V324A possibly damaging Het
Mefv T C 16: 3,535,691 (GRCm39) Q79R probably damaging Het
Mettl17 T C 14: 52,126,254 (GRCm39) S168P probably damaging Het
Mpp4 A T 1: 59,197,811 (GRCm39) S23T probably benign Het
Nabp1 A T 1: 51,517,004 (GRCm39) V24D probably damaging Het
Nod2 T A 8: 89,390,836 (GRCm39) F359Y probably damaging Het
Or10g1b C T 14: 52,628,037 (GRCm39) M64I probably benign Het
Or1p1c A T 11: 74,160,670 (GRCm39) T152S probably damaging Het
Or51b17 T G 7: 103,542,925 (GRCm39) S6R probably benign Het
Or52d3 C A 7: 104,229,116 (GRCm39) L88M probably damaging Het
Or5ak4 T C 2: 85,161,444 (GRCm39) D266G probably benign Het
Or5b107 T C 19: 13,142,560 (GRCm39) Y61H probably damaging Het
Or6a2 C T 7: 106,600,342 (GRCm39) A242T probably damaging Het
Or7a39 A G 10: 78,715,267 (GRCm39) Q87R probably benign Het
Pcdh18 T C 3: 49,710,400 (GRCm39) H305R probably benign Het
Phf1 T A 17: 27,154,719 (GRCm39) probably null Het
Pold3 T C 7: 99,737,318 (GRCm39) K379R probably benign Het
Polr1f T A 12: 33,487,817 (GRCm39) V244D probably benign Het
Pou2f3 T A 9: 43,056,534 (GRCm39) T108S probably benign Het
Prdm5 C A 6: 65,913,060 (GRCm39) T203K probably damaging Het
Psma5 A G 3: 108,173,760 (GRCm39) S79G probably benign Het
Ptk2 A T 15: 73,087,832 (GRCm39) V902D possibly damaging Het
Rad54l T A 4: 115,967,554 (GRCm39) I243F probably damaging Het
Ralgapa2 A G 2: 146,302,679 (GRCm39) F95L probably benign Het
Rassf6 G A 5: 90,763,730 (GRCm39) Q71* probably null Het
Ryr2 A T 13: 11,695,966 (GRCm39) L2967H probably damaging Het
Scn5a T C 9: 119,346,479 (GRCm39) T1058A possibly damaging Het
Sdk1 T C 5: 142,080,336 (GRCm39) L1276P probably damaging Het
Serpina12 T G 12: 104,002,048 (GRCm39) T223P probably damaging Het
Sh3yl1 A G 12: 30,992,787 (GRCm39) probably null Het
Spata31g1 A T 4: 42,970,105 (GRCm39) probably null Het
St6galnac5 T A 3: 152,552,120 (GRCm39) Q149L probably benign Het
Stam2 T C 2: 52,598,239 (GRCm39) probably null Het
Tac2 A G 10: 127,564,349 (GRCm39) probably null Het
Tbata G A 10: 61,019,256 (GRCm39) D271N probably damaging Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tektl1 A G 10: 78,586,373 (GRCm39) probably null Het
Thra T A 11: 98,654,567 (GRCm39) D312E probably benign Het
Tlr1 T A 5: 65,082,520 (GRCm39) I686F probably damaging Het
Tmem86b A T 7: 4,631,706 (GRCm39) F115L probably benign Het
Tmem94 A G 11: 115,679,500 (GRCm39) D259G possibly damaging Het
Trim69 G A 2: 122,004,956 (GRCm39) probably null Het
Usp43 T A 11: 67,795,159 (GRCm39) Q243L probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn2r104 A T 17: 20,262,313 (GRCm39) N272K probably damaging Het
Vmn2r26 G A 6: 124,030,846 (GRCm39) C527Y probably damaging Het
Vmn2r84 G A 10: 130,226,677 (GRCm39) A387V probably benign Het
Vps13b A T 15: 35,869,553 (GRCm39) I2686F probably damaging Het
Vps8 C T 16: 21,279,892 (GRCm39) T281M probably damaging Het
Wdfy3 A G 5: 102,067,275 (GRCm39) V1219A probably benign Het
Wnt9b A G 11: 103,621,638 (GRCm39) C340R probably damaging Het
Zfhx3 T C 8: 109,520,774 (GRCm39) V632A probably benign Het
Zfp1006 A T 8: 129,948,309 (GRCm39) D41E possibly damaging Het
Zfp341 A T 2: 154,480,132 (GRCm39) T528S probably benign Het
Zfp990 G A 4: 145,261,452 (GRCm39) A33T probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zyx A T 6: 42,328,289 (GRCm39) K166I probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGAAGTAATTGCTAGTGTCATAAGG -3'
(R):5'- AGCTTTTCCATCGAGAGTCAAATTC -3'

Sequencing Primer
(F):5'- AGTATATATGCCTGTAACTTCCCTG -3'
(R):5'- CATGTTTATGAGATCCTTGGAAGTGC -3'
Posted On 2014-08-01