Incidental Mutation 'R1956:Atg2b'
ID217834
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Nameautophagy related 2B
Synonyms
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location105616136-105685211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105669418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 197 (Y197C)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
Predicted Effect probably damaging
Transcript: ENSMUST00000041055
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: Y197C

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221568
Meta Mutation Damage Score 0.6267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105644916 missense probably benign 0.20
IGL01326:Atg2b APN 12 105622144 missense probably damaging 1.00
IGL02063:Atg2b APN 12 105648322 missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105636440 splice site probably benign
IGL02376:Atg2b APN 12 105645468 missense probably damaging 1.00
IGL02381:Atg2b APN 12 105648348 missense probably damaging 1.00
IGL02434:Atg2b APN 12 105639207 missense probably benign 0.00
IGL02534:Atg2b APN 12 105643267 missense probably damaging 1.00
IGL03011:Atg2b APN 12 105626362 missense probably damaging 0.98
IGL03173:Atg2b APN 12 105658294 missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105671529 missense possibly damaging 0.90
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0511:Atg2b UTSW 12 105617153 missense probably damaging 1.00
R0762:Atg2b UTSW 12 105674970 missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105636508 missense probably benign 0.00
R1029:Atg2b UTSW 12 105635773 missense probably damaging 0.96
R1529:Atg2b UTSW 12 105661133 missense probably benign
R1563:Atg2b UTSW 12 105623488 missense probably damaging 0.99
R1746:Atg2b UTSW 12 105669329 missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105654092 missense probably benign 0.01
R1957:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R2272:Atg2b UTSW 12 105638008 missense probably benign 0.00
R2877:Atg2b UTSW 12 105664009 nonsense probably null
R2878:Atg2b UTSW 12 105664009 nonsense probably null
R4798:Atg2b UTSW 12 105652629 missense probably benign 0.37
R4836:Atg2b UTSW 12 105646814 missense probably benign
R5007:Atg2b UTSW 12 105643876 splice site probably null
R5042:Atg2b UTSW 12 105621262 missense probably benign 0.01
R5134:Atg2b UTSW 12 105674950 missense probably damaging 0.96
R5212:Atg2b UTSW 12 105646796 missense probably benign 0.00
R5250:Atg2b UTSW 12 105635765 missense probably damaging 1.00
R5307:Atg2b UTSW 12 105658329 missense probably benign 0.17
R5342:Atg2b UTSW 12 105658916 missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105649155 missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105621328 missense probably benign 0.00
R5660:Atg2b UTSW 12 105649124 nonsense probably null
R5903:Atg2b UTSW 12 105639359 missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105661171 missense probably damaging 0.96
R6153:Atg2b UTSW 12 105623482 missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105661092 nonsense probably null
R6584:Atg2b UTSW 12 105657995 missense probably damaging 1.00
R6593:Atg2b UTSW 12 105644848 missense probably damaging 1.00
R6669:Atg2b UTSW 12 105671529 missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105635788 missense probably damaging 1.00
R7003:Atg2b UTSW 12 105654249 missense probably benign 0.01
R7193:Atg2b UTSW 12 105664708 missense probably damaging 1.00
R7387:Atg2b UTSW 12 105622775 missense probably damaging 1.00
R7432:Atg2b UTSW 12 105661204 missense probably damaging 0.98
R7432:Atg2b UTSW 12 105664698 missense probably benign 0.08
R7630:Atg2b UTSW 12 105646954 critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105652120 missense probably damaging 1.00
R7645:Atg2b UTSW 12 105623430 missense probably benign 0.06
R7653:Atg2b UTSW 12 105636472 missense possibly damaging 0.68
X0018:Atg2b UTSW 12 105666697 missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105646785 missense probably benign 0.12
Z1177:Atg2b UTSW 12 105635764 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGATTATGCTTCATTTTCCTTAC -3'
(R):5'- CAAAGATGCATGACGATATCCAG -3'

Sequencing Primer
(F):5'- TACCACTGGTGCAGTTGAAC -3'
(R):5'- ACCTTTGGAAGAGCAGTCAGTTCC -3'
Posted On2014-08-01