Incidental Mutation 'R0133:Vmn2r92'
ID21785
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0133 (G1)
Quality Score215
Status Validated (trace)
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18167957 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 408 (A408V)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably damaging
Transcript: ENSMUST00000169686
AA Change: A408V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: A408V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0227:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4742:Vmn2r92 UTSW 17 18166857 missense probably benign 0.06
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R4900:Vmn2r92 UTSW 17 18184343 missense probably benign 0.27
R5084:Vmn2r92 UTSW 17 18185177 makesense probably null
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6269:Vmn2r92 UTSW 17 18166774 missense probably benign 0.01
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
R7514:Vmn2r92 UTSW 17 18171271 missense probably damaging 1.00
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGTATTTCTTCTTCAAGTGCTC -3'
(R):5'- GCTCCGGTGTTGAAAATGAGGGT -3'

Sequencing Primer
(F):5'- CTTCAAGTGCTCATTTGCTGG -3'
(R):5'- TGTACAGCTAGATACTGATGACAAG -3'
Posted On2013-04-12