Incidental Mutation 'R1956:Vmn2r104'
ID 217850
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
MMRRC Submission 039970-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1956 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20249687-20268467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20262313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 272 (N272K)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect probably damaging
Transcript: ENSMUST00000168050
AA Change: N272K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: N272K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,908,316 (GRCm39) D157V probably damaging Het
Abcg5 A G 17: 84,977,803 (GRCm39) V151A probably damaging Het
Acss3 A G 10: 106,772,029 (GRCm39) V682A probably benign Het
Adamts9 A T 6: 92,836,830 (GRCm39) C641S probably damaging Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Ankrd27 T A 7: 35,303,264 (GRCm39) Y215N probably damaging Het
Arhgef7 T A 8: 11,855,266 (GRCm39) L182Q probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Arrdc4 T C 7: 68,391,547 (GRCm39) K240R probably benign Het
Atg2b T C 12: 105,635,677 (GRCm39) Y197C probably damaging Het
Atp13a2 A G 4: 140,731,572 (GRCm39) K907R possibly damaging Het
Cadps2 A T 6: 23,287,685 (GRCm39) M1160K probably damaging Het
Cdk12 A G 11: 98,110,042 (GRCm39) T688A probably benign Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Crabp2 T C 3: 87,856,193 (GRCm39) F16L probably damaging Het
Creb3 A G 4: 43,563,279 (GRCm39) probably null Het
Crk T C 11: 75,583,496 (GRCm39) Y239H possibly damaging Het
Cyp3a13 A G 5: 137,908,204 (GRCm39) I215T probably benign Het
D130043K22Rik A G 13: 25,069,578 (GRCm39) Y879C probably damaging Het
Depdc5 T C 5: 33,061,175 (GRCm39) V334A probably damaging Het
Dgkh T C 14: 78,855,981 (GRCm39) N231S probably damaging Het
Disp2 T A 2: 118,622,704 (GRCm39) H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 (GRCm39) T563A possibly damaging Het
Ephb3 G A 16: 21,040,132 (GRCm39) R498H probably damaging Het
F10 T C 8: 13,105,422 (GRCm39) I329T probably damaging Het
Fam13b G T 18: 34,578,382 (GRCm39) Q760K possibly damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fpr-rs4 A G 17: 18,242,518 (GRCm39) Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 (GRCm39) M528K probably damaging Het
Gcc2 A G 10: 58,121,965 (GRCm39) H1134R possibly damaging Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Ggn T A 7: 28,871,341 (GRCm39) S240R probably damaging Het
Git2 C T 5: 114,887,398 (GRCm39) W299* probably null Het
Gm42669 A T 5: 107,656,738 (GRCm39) E355D possibly damaging Het
Gm5134 T C 10: 75,840,680 (GRCm39) F508S possibly damaging Het
Gm9923 G T 10: 72,145,490 (GRCm39) V114L probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Heatr5a A G 12: 51,992,202 (GRCm39) probably null Het
Hnrnpk A T 13: 58,544,000 (GRCm39) probably null Het
Ifna4 A T 4: 88,760,311 (GRCm39) I72F probably damaging Het
Ip6k3 A T 17: 27,370,142 (GRCm39) L92Q probably benign Het
Itpripl1 T C 2: 126,983,927 (GRCm39) E65G probably damaging Het
Kcnh5 G C 12: 74,944,358 (GRCm39) Q964E probably benign Het
Kmt2d A G 15: 98,757,471 (GRCm39) probably benign Het
Lrrc69 A G 4: 14,665,986 (GRCm39) V324A possibly damaging Het
Mefv T C 16: 3,535,691 (GRCm39) Q79R probably damaging Het
Mettl17 T C 14: 52,126,254 (GRCm39) S168P probably damaging Het
Mpp4 A T 1: 59,197,811 (GRCm39) S23T probably benign Het
Nabp1 A T 1: 51,517,004 (GRCm39) V24D probably damaging Het
Nod2 T A 8: 89,390,836 (GRCm39) F359Y probably damaging Het
Or10g1b C T 14: 52,628,037 (GRCm39) M64I probably benign Het
Or1p1c A T 11: 74,160,670 (GRCm39) T152S probably damaging Het
Or51b17 T G 7: 103,542,925 (GRCm39) S6R probably benign Het
Or52d3 C A 7: 104,229,116 (GRCm39) L88M probably damaging Het
Or5ak4 T C 2: 85,161,444 (GRCm39) D266G probably benign Het
Or5b107 T C 19: 13,142,560 (GRCm39) Y61H probably damaging Het
Or6a2 C T 7: 106,600,342 (GRCm39) A242T probably damaging Het
Or7a39 A G 10: 78,715,267 (GRCm39) Q87R probably benign Het
Pcdh18 T C 3: 49,710,400 (GRCm39) H305R probably benign Het
Phf1 T A 17: 27,154,719 (GRCm39) probably null Het
Pold3 T C 7: 99,737,318 (GRCm39) K379R probably benign Het
Polr1f T A 12: 33,487,817 (GRCm39) V244D probably benign Het
Pou2f3 T A 9: 43,056,534 (GRCm39) T108S probably benign Het
Prdm5 C A 6: 65,913,060 (GRCm39) T203K probably damaging Het
Psma5 A G 3: 108,173,760 (GRCm39) S79G probably benign Het
Psme4 T A 11: 30,782,424 (GRCm39) S889T probably damaging Het
Ptk2 A T 15: 73,087,832 (GRCm39) V902D possibly damaging Het
Rad54l T A 4: 115,967,554 (GRCm39) I243F probably damaging Het
Ralgapa2 A G 2: 146,302,679 (GRCm39) F95L probably benign Het
Rassf6 G A 5: 90,763,730 (GRCm39) Q71* probably null Het
Ryr2 A T 13: 11,695,966 (GRCm39) L2967H probably damaging Het
Scn5a T C 9: 119,346,479 (GRCm39) T1058A possibly damaging Het
Sdk1 T C 5: 142,080,336 (GRCm39) L1276P probably damaging Het
Serpina12 T G 12: 104,002,048 (GRCm39) T223P probably damaging Het
Sh3yl1 A G 12: 30,992,787 (GRCm39) probably null Het
Spata31g1 A T 4: 42,970,105 (GRCm39) probably null Het
St6galnac5 T A 3: 152,552,120 (GRCm39) Q149L probably benign Het
Stam2 T C 2: 52,598,239 (GRCm39) probably null Het
Tac2 A G 10: 127,564,349 (GRCm39) probably null Het
Tbata G A 10: 61,019,256 (GRCm39) D271N probably damaging Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tektl1 A G 10: 78,586,373 (GRCm39) probably null Het
Thra T A 11: 98,654,567 (GRCm39) D312E probably benign Het
Tlr1 T A 5: 65,082,520 (GRCm39) I686F probably damaging Het
Tmem86b A T 7: 4,631,706 (GRCm39) F115L probably benign Het
Tmem94 A G 11: 115,679,500 (GRCm39) D259G possibly damaging Het
Trim69 G A 2: 122,004,956 (GRCm39) probably null Het
Usp43 T A 11: 67,795,159 (GRCm39) Q243L probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn2r26 G A 6: 124,030,846 (GRCm39) C527Y probably damaging Het
Vmn2r84 G A 10: 130,226,677 (GRCm39) A387V probably benign Het
Vps13b A T 15: 35,869,553 (GRCm39) I2686F probably damaging Het
Vps8 C T 16: 21,279,892 (GRCm39) T281M probably damaging Het
Wdfy3 A G 5: 102,067,275 (GRCm39) V1219A probably benign Het
Wnt9b A G 11: 103,621,638 (GRCm39) C340R probably damaging Het
Zfhx3 T C 8: 109,520,774 (GRCm39) V632A probably benign Het
Zfp1006 A T 8: 129,948,309 (GRCm39) D41E possibly damaging Het
Zfp341 A T 2: 154,480,132 (GRCm39) T528S probably benign Het
Zfp990 G A 4: 145,261,452 (GRCm39) A33T probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zyx A T 6: 42,328,289 (GRCm39) K166I probably damaging Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20,258,501 (GRCm39) missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20,268,358 (GRCm39) missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20,263,055 (GRCm39) missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20,263,158 (GRCm39) missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20,260,930 (GRCm39) missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20,250,187 (GRCm39) missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20,262,056 (GRCm39) nonsense probably null
IGL02305:Vmn2r104 APN 17 20,263,118 (GRCm39) missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20,263,048 (GRCm39) missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20,263,083 (GRCm39) missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20,249,866 (GRCm39) missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20,262,075 (GRCm39) missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20,250,069 (GRCm39) missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20,249,889 (GRCm39) missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20,268,264 (GRCm39) nonsense probably null
R0709:Vmn2r104 UTSW 17 20,263,166 (GRCm39) missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20,262,987 (GRCm39) missense probably benign
R1575:Vmn2r104 UTSW 17 20,262,477 (GRCm39) missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20,262,497 (GRCm39) missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20,261,031 (GRCm39) missense probably damaging 1.00
R2203:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20,268,455 (GRCm39) missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20,249,818 (GRCm39) missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20,250,183 (GRCm39) missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20,250,147 (GRCm39) missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20,262,503 (GRCm39) missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20,268,443 (GRCm39) missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20,261,030 (GRCm39) nonsense probably null
R4911:Vmn2r104 UTSW 17 20,250,288 (GRCm39) missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20,258,528 (GRCm39) missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20,262,146 (GRCm39) missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20,250,163 (GRCm39) missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20,250,450 (GRCm39) missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20,250,343 (GRCm39) missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20,260,981 (GRCm39) nonsense probably null
R5795:Vmn2r104 UTSW 17 20,250,372 (GRCm39) missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20,250,544 (GRCm39) missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20,249,733 (GRCm39) missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20,261,970 (GRCm39) missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20,249,747 (GRCm39) missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20,258,573 (GRCm39) missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20,261,909 (GRCm39) missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20,250,507 (GRCm39) missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20,261,829 (GRCm39) missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20,249,848 (GRCm39) missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20,262,487 (GRCm39) missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20,250,358 (GRCm39) missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20,261,088 (GRCm39) missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20,249,737 (GRCm39) missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20,249,791 (GRCm39) missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20,261,971 (GRCm39) missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8031:Vmn2r104 UTSW 17 20,263,048 (GRCm39) missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20,250,483 (GRCm39) missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20,250,465 (GRCm39) missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20,261,040 (GRCm39) missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20,262,110 (GRCm39) missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8900:Vmn2r104 UTSW 17 20,261,924 (GRCm39) missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20,249,968 (GRCm39) missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20,262,097 (GRCm39) missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20,261,098 (GRCm39) missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20,268,433 (GRCm39) missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20,250,250 (GRCm39) missense probably damaging 0.99
R9785:Vmn2r104 UTSW 17 20,268,409 (GRCm39) missense probably benign
RF007:Vmn2r104 UTSW 17 20,268,302 (GRCm39) missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20,250,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGAGCATATACACCATTG -3'
(R):5'- GTCTTGGATTGGCCTCATCATC -3'

Sequencing Primer
(F):5'- CACCATTGTAAATGTTTGTGCTC -3'
(R):5'- ATTGGCCTCATCATCCCCGATAAC -3'
Posted On 2014-08-01