Incidental Mutation 'R1956:Olfr1461'
ID217858
Institutional Source Beutler Lab
Gene Symbol Olfr1461
Ensembl Gene ENSMUSG00000045883
Gene Nameolfactory receptor 1461
SynonymsGA_x6K02T2RE5P-3491834-3492772, MOR202-35
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1956 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13163000-13168130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13165196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 61 (Y61H)
Ref Sequence ENSEMBL: ENSMUSP00000146723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053772] [ENSMUST00000207113] [ENSMUST00000208489]
Predicted Effect probably damaging
Transcript: ENSMUST00000053772
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053269
Gene: ENSMUSG00000045883
AA Change: Y61H

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 6e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 8e-6 PFAM
Pfam:7tm_1 42 291 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207113
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208489
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Kmt2d A G 15: 98,859,590 probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Olfr1461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1461 APN 19 13165371 missense probably damaging 1.00
IGL01370:Olfr1461 APN 19 13165299 missense possibly damaging 0.95
IGL01936:Olfr1461 APN 19 13165403 missense probably damaging 1.00
R0098:Olfr1461 UTSW 19 13165662 missense probably benign 0.12
R0270:Olfr1461 UTSW 19 13165887 missense probably damaging 1.00
R0575:Olfr1461 UTSW 19 13165387 nonsense probably null
R0627:Olfr1461 UTSW 19 13165250 missense probably benign 0.43
R1779:Olfr1461 UTSW 19 13165040 missense probably benign 0.00
R2446:Olfr1461 UTSW 19 13165447 missense probably benign 0.00
R3622:Olfr1461 UTSW 19 13165656 missense probably benign 0.06
R4485:Olfr1461 UTSW 19 13165491 missense possibly damaging 0.54
R4605:Olfr1461 UTSW 19 13165248 missense probably damaging 1.00
R4757:Olfr1461 UTSW 19 13165913 missense probably benign 0.01
R4816:Olfr1461 UTSW 19 13165124 missense probably benign 0.10
R5038:Olfr1461 UTSW 19 13165591 missense probably benign 0.39
R7026:Olfr1461 UTSW 19 13165415 missense probably benign 0.08
R8225:Olfr1461 UTSW 19 13165143 missense probably damaging 1.00
R8232:Olfr1461 UTSW 19 13165319 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCTACAGACCATCACATTGTGG -3'
(R):5'- TAGCGATCATAGGCCATTGAGG -3'

Sequencing Primer
(F):5'- TTGTGGAAAACAATGACACTGGTG -3'
(R):5'- GAGGCCAACAGGTAATTTTCC -3'
Posted On2014-08-01