Mutagenetix > Incidental Mutations

Incidental Mutation 'R0133:Rasal3'

21786

Institutional Source

Beutler Lab

Gene Symbol

Rasal3

Ensembl Gene

ENSMUSG00000052142

Gene Name

RAS protein activator like 3

Synonyms

A430107D22Rik

MMRRC Submission

038418-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R0133 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

32390659-32403583 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to C at 32403383 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000118738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063824
AA Change: M23V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: M23V

Domain	Start	End	E-Value	Type
low complexity region	57	72	N/A	INTRINSIC
low complexity region	120	137	N/A	INTRINSIC
PH	165	323	3.94e0	SMART
Blast:RasGAP	354	381	9e-8	BLAST
low complexity region	385	402	N/A	INTRINSIC
RasGAP	433	755	2.03e-81	SMART
low complexity region	826	839	N/A	INTRINSIC
coiled coil region	932	1013	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135560

Predicted Effect

probably null
Transcript: ENSMUST00000135618
AA Change: M1V

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: M1V

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	9e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
RasGAP	411	733	2.03e-81	SMART
low complexity region	804	817	N/A	INTRINSIC
coiled coil region	910	991	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000136375
AA Change: M1V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: M1V

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	7e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
Pfam:RasGAP	483	579	6.4e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000137458
AA Change: M1V

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: M1V

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	119	140	N/A	INTRINSIC
PH	167	325	3.94e0	SMART
Blast:RasGAP	356	383	9e-8	BLAST
low complexity region	387	404	N/A	INTRINSIC
RasGAP	435	757	2.03e-81	SMART
low complexity region	828	841	N/A	INTRINSIC
coiled coil region	934	1015	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142203

Meta Mutation Damage Score

0.8613

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.2%
20x: 89.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	C	11: 103,105,388	S172P	probably damaging	Het
Akap6	A	T	12: 53,139,471	K1223*	probably null	Het
Akna	G	A	4: 63,379,361	Q819*	probably null	Het
Ankrd2	T	C	19: 42,044,071	V257A	probably benign	Het
Arap1	T	A	7: 101,386,229	D30E	probably damaging	Het
Atp6v0d2	T	C	4: 19,910,578		probably benign	Het
Blm	T	A	7: 80,502,367	I611F	possibly damaging	Het
Ccng2	A	G	5: 93,273,381	K250R	probably benign	Het
Cdhr3	A	G	12: 33,092,752	L8P	possibly damaging	Het
Csf2rb	T	G	15: 78,339,004		probably benign	Het
Ctbs	A	G	3: 146,457,468	I204V	probably benign	Het
Cxcl16	T	A	11: 70,458,770	E76D	possibly damaging	Het
Dhx15	T	C	5: 52,154,072	I689V	possibly damaging	Het
Dlk2	T	C	17: 46,298,942		probably benign	Het
Dnah2	A	T	11: 69,421,009	M4452K	probably damaging	Het
Dok4	T	A	8: 94,865,363	I280F	probably benign	Het
Dsc3	T	C	18: 19,971,582	T563A	probably damaging	Het
Dsg1b	C	T	18: 20,404,878	A617V	probably damaging	Het
Eps8l2	C	T	7: 141,362,207	P721S	unknown	Het
Evx2	T	C	2: 74,659,082	D112G	possibly damaging	Het
Fam124a	C	A	14: 62,606,333	T430K	possibly damaging	Het
Fbrs	C	T	7: 127,489,610		probably benign	Het
Fbxw14	T	C	9: 109,274,579	T22A	probably benign	Het
Fmo5	T	G	3: 97,645,636	V300G	probably damaging	Het
Gadl1	T	C	9: 115,941,343	S75P	probably benign	Het
Galnt2	T	G	8: 124,338,538	I469S	probably benign	Het
Gga3	T	A	11: 115,588,979		probably benign	Het
Gm10647	T	C	9: 66,798,489		probably benign	Het
Gm14180	C	A	11: 99,734,217	C25F	unknown	Het
Grid2	A	T	6: 64,320,132	D493V	probably damaging	Het
Gzmc	T	A	14: 56,232,297	Y182F	possibly damaging	Het
Hecw2	A	C	1: 53,830,740	L1443R	probably damaging	Het
Igkv4-62	A	G	6: 69,400,069	I32T	probably benign	Het
Ikzf1	T	A	11: 11,741,015		probably null	Het
Il27ra	G	A	8: 84,033,942		probably benign	Het
Jmjd1c	C	A	10: 67,240,808	A2137D	probably benign	Het
Kcnc2	T	C	10: 112,458,597	C579R	probably damaging	Het
Kdr	T	C	5: 75,951,838	T862A	probably damaging	Het
Kif17	T	C	4: 138,278,245	S182P	possibly damaging	Het
Klf5	A	T	14: 99,301,882	T164S	probably benign	Het
Ksr2	T	G	5: 117,555,294	V269G	possibly damaging	Het
Mcm5	T	A	8: 75,120,911	D445E	probably damaging	Het
Mlkl	T	C	8: 111,327,948	I186V	probably damaging	Het
Muc4	A	T	16: 32,771,604	S3017C	possibly damaging	Het
Myo15	T	C	11: 60,477,850	F479L	possibly damaging	Het
Myo6	A	G	9: 80,273,975		probably benign	Het
Myom1	T	A	17: 71,047,787	V393E	probably damaging	Het
Nup98	T	A	7: 102,139,652		probably null	Het
Odf2l	A	G	3: 145,148,541	N383S	probably damaging	Het
Olfml3	A	C	3: 103,737,026		probably null	Het
Olfr1057	A	T	2: 86,374,815	V199E	possibly damaging	Het
Olfr1494	T	A	19: 13,749,988	I294N	probably damaging	Het
Olfr1537	A	G	9: 39,238,011	Y141H	probably benign	Het
Olfr829	G	A	9: 18,856,629	M1I	probably null	Het
Plxna4	A	T	6: 32,197,074	D1195E	probably benign	Het
Ppp1r1a	T	A	15: 103,537,820	H20L	probably damaging	Het
Prdm4	A	G	10: 85,910,221		probably null	Het
Prom2	A	G	2: 127,538,338		probably benign	Het
Rhoj	A	G	12: 75,394,420		probably null	Het
Rnf40	C	T	7: 127,596,860		probably null	Het
Slc15a3	T	C	19: 10,843,250	L77P	probably damaging	Het
Slc26a6	T	C	9: 108,861,323	V586A	possibly damaging	Het
Slc30a10	T	A	1: 185,455,173	L37Q	probably damaging	Het
Slc43a2	T	A	11: 75,563,577	M316K	probably benign	Het
Smarcal1	T	C	1: 72,632,851	F844L	probably benign	Het
Snx19	A	G	9: 30,428,616	E350G	possibly damaging	Het
Tecta	T	A	9: 42,367,228	T995S	probably benign	Het
Tmc3	T	G	7: 83,612,473	N586K	probably damaging	Het
Tmem107	T	A	11: 69,072,413		probably benign	Het
Tmem247	A	G	17: 86,918,561	Q51R	probably benign	Het
Tmpo	G	T	10: 91,164,038		probably benign	Het
Ubr5	T	A	15: 37,996,571	T1894S	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Xirp2	T	A	2: 67,517,124	H3236Q	probably benign	Het
Zfand4	G	A	6: 116,314,739	D545N	probably benign	Het
Zkscan3	G	T	13: 21,394,774	P155T	possibly damaging	Het

Other mutations in Rasal3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Rasal3	APN	17	32397405	missense	possibly damaging	0.89
IGL02291:Rasal3	APN	17	32393737	unclassified	probably benign
IGL02346:Rasal3	APN	17	32399349	missense	probably damaging	1.00
IGL02422:Rasal3	APN	17	32398973	missense	probably benign	0.11
Beaten	UTSW	17	32391344	missense	probably benign	0.05
bent	UTSW	17	32396781	missense	probably damaging	1.00
bowed	UTSW	17	32396790	missense	probably damaging	1.00
kinked	UTSW	17	32396350	nonsense	probably null
R0057:Rasal3	UTSW	17	32391383	missense	probably benign	0.00
R0180:Rasal3	UTSW	17	32399405	missense	probably benign
R0403:Rasal3	UTSW	17	32392790	splice site	probably null
R0452:Rasal3	UTSW	17	32395817	splice site	probably benign
R0600:Rasal3	UTSW	17	32393526	missense	probably damaging	0.99
R0760:Rasal3	UTSW	17	32392172	missense	probably benign	0.00
R1438:Rasal3	UTSW	17	32393535	splice site	probably null
R1669:Rasal3	UTSW	17	32403098	missense	possibly damaging	0.81
R1914:Rasal3	UTSW	17	32396350	nonsense	probably null
R1928:Rasal3	UTSW	17	32397353	missense	probably damaging	1.00
R2002:Rasal3	UTSW	17	32393611	missense	probably damaging	1.00
R3053:Rasal3	UTSW	17	32403439	missense	probably benign	0.03
R3770:Rasal3	UTSW	17	32392151	missense	probably damaging	0.99
R3870:Rasal3	UTSW	17	32393548	missense	possibly damaging	0.94
R4491:Rasal3	UTSW	17	32391385	missense	probably damaging	0.99
R4783:Rasal3	UTSW	17	32396781	missense	probably damaging	1.00
R4788:Rasal3	UTSW	17	32399338	missense	probably benign	0.00
R4903:Rasal3	UTSW	17	32397383	missense	probably damaging	1.00
R5185:Rasal3	UTSW	17	32396790	missense	probably damaging	1.00
R5372:Rasal3	UTSW	17	32391344	missense	probably benign	0.05
R5433:Rasal3	UTSW	17	32393601	missense	probably benign	0.00
R5472:Rasal3	UTSW	17	32396669	missense	probably damaging	1.00
R5920:Rasal3	UTSW	17	32395169	missense	probably damaging	1.00
R6436:Rasal3	UTSW	17	32397504	missense	probably damaging	1.00
R6837:Rasal3	UTSW	17	32403070	missense	probably benign	0.17
R7047:Rasal3	UTSW	17	32396484	missense	probably damaging	1.00
R7109:Rasal3	UTSW	17	32392709	missense	probably damaging	1.00
R7179:Rasal3	UTSW	17	32392417	missense	probably damaging	0.99
R7571:Rasal3	UTSW	17	32395861	missense	possibly damaging	0.76
R7768:Rasal3	UTSW	17	32396793	missense	probably damaging	0.96
R7874:Rasal3	UTSW	17	32396707	missense	possibly damaging	0.75
R8155:Rasal3	UTSW	17	32397407	missense	possibly damaging	0.93
R8265:Rasal3	UTSW	17	32395820	critical splice donor site	probably null
R8544:Rasal3	UTSW	17	32392119	missense	probably benign
RF004:Rasal3	UTSW	17	32391107	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32391219	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32392526	missense	probably benign	0.00
X0065:Rasal3	UTSW	17	32403286	missense	probably damaging	1.00
Z1177:Rasal3	UTSW	17	32399310	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GAGGGCTGATGCTAGATTGACAGAC -3'
(R):5'- TTCTCGTCAGAAGCCAGAACTGC -3'

Sequencing Primer
(F):5'- CGATTGGACCGTGACTCCTTAG -3'
(R):5'- ATGAAGCCAGAATGTGGGCA -3'

Posted On

2013-04-12