Incidental Mutation 'R0133:Dlk2'
ID21787
Institutional Source Beutler Lab
Gene Symbol Dlk2
Ensembl Gene ENSMUSG00000047428
Gene Namedelta like non-canonical Notch ligand 2
SynonymsEgfl9
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0133 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46297421-46303271 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 46298942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000061722] [ENSMUST00000095261] [ENSMUST00000166280] [ENSMUST00000166617] [ENSMUST00000167360] [ENSMUST00000170271] [ENSMUST00000171584] [ENSMUST00000188223]
Predicted Effect probably benign
Transcript: ENSMUST00000047970
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061722
SMART Domains Protein: ENSMUSP00000058470
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
EGF_like 71 101 3.16e1 SMART
EGF 102 132 7.76e-3 SMART
EGF 137 172 2.14e-5 SMART
EGF 177 215 3.79e-6 SMART
EGF_CA 217 253 3.1e-11 SMART
EGF_CA 255 291 9.47e-7 SMART
transmembrane domain 349 371 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095261
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166280
SMART Domains Protein: ENSMUSP00000126993
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166617
SMART Domains Protein: ENSMUSP00000128897
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167360
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170271
SMART Domains Protein: ENSMUSP00000132349
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188223
SMART Domains Protein: ENSMUSP00000141164
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
Pfam:hEGF 88 100 7.9e-4 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Dlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Dlk2 APN 17 46302464 missense probably damaging 1.00
IGL03242:Dlk2 APN 17 46302977 missense probably benign 0.00
R0167:Dlk2 UTSW 17 46302604 missense possibly damaging 0.73
R0462:Dlk2 UTSW 17 46303098 makesense probably null
R4809:Dlk2 UTSW 17 46299014 splice site probably null
R6109:Dlk2 UTSW 17 46301697 missense probably damaging 1.00
R6520:Dlk2 UTSW 17 46302512 missense probably damaging 1.00
R7590:Dlk2 UTSW 17 46298683 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTAAATCTCGTGTGCCTGC -3'
(R):5'- ACTGTGGCTCTCAGTCCCTAAACTC -3'

Sequencing Primer
(F):5'- TGGCACGTTGACCTCTG -3'
(R):5'- ggggagaggagaggaggg -3'
Posted On2013-04-12