Mutagenetix > Incidental Mutation

Incidental Mutation 'R0133:Myom1'

21788

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

038418-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0133 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71047787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 393 (V393E)

Ref Sequence

ENSEMBL: ENSMUSP00000136266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

Predicted Effect

probably damaging
Transcript: ENSMUST00000024847
AA Change: V393E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V393E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073211
AA Change: V393E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V393E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179759
AA Change: V393E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V393E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Meta Mutation Damage Score

0.3962

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.2%
20x: 89.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	C	11: 103,105,388	S172P	probably damaging	Het
Akap6	A	T	12: 53,139,471	K1223*	probably null	Het
Akna	G	A	4: 63,379,361	Q819*	probably null	Het
Ankrd2	T	C	19: 42,044,071	V257A	probably benign	Het
Arap1	T	A	7: 101,386,229	D30E	probably damaging	Het
Atp6v0d2	T	C	4: 19,910,578		probably benign	Het
Blm	T	A	7: 80,502,367	I611F	possibly damaging	Het
Ccng2	A	G	5: 93,273,381	K250R	probably benign	Het
Cdhr3	A	G	12: 33,092,752	L8P	possibly damaging	Het
Csf2rb	T	G	15: 78,339,004		probably benign	Het
Ctbs	A	G	3: 146,457,468	I204V	probably benign	Het
Cxcl16	T	A	11: 70,458,770	E76D	possibly damaging	Het
Dhx15	T	C	5: 52,154,072	I689V	possibly damaging	Het
Dlk2	T	C	17: 46,298,942		probably benign	Het
Dnah2	A	T	11: 69,421,009	M4452K	probably damaging	Het
Dok4	T	A	8: 94,865,363	I280F	probably benign	Het
Dsc3	T	C	18: 19,971,582	T563A	probably damaging	Het
Dsg1b	C	T	18: 20,404,878	A617V	probably damaging	Het
Eps8l2	C	T	7: 141,362,207	P721S	unknown	Het
Evx2	T	C	2: 74,659,082	D112G	possibly damaging	Het
Fam124a	C	A	14: 62,606,333	T430K	possibly damaging	Het
Fbrs	C	T	7: 127,489,610		probably benign	Het
Fbxw14	T	C	9: 109,274,579	T22A	probably benign	Het
Fmo5	T	G	3: 97,645,636	V300G	probably damaging	Het
Gadl1	T	C	9: 115,941,343	S75P	probably benign	Het
Galnt2	T	G	8: 124,338,538	I469S	probably benign	Het
Gga3	T	A	11: 115,588,979		probably benign	Het
Gm10647	T	C	9: 66,798,489		probably benign	Het
Gm14180	C	A	11: 99,734,217	C25F	unknown	Het
Grid2	A	T	6: 64,320,132	D493V	probably damaging	Het
Gzmc	T	A	14: 56,232,297	Y182F	possibly damaging	Het
Hecw2	A	C	1: 53,830,740	L1443R	probably damaging	Het
Igkv4-62	A	G	6: 69,400,069	I32T	probably benign	Het
Ikzf1	T	A	11: 11,741,015		probably null	Het
Il27ra	G	A	8: 84,033,942		probably benign	Het
Jmjd1c	C	A	10: 67,240,808	A2137D	probably benign	Het
Kcnc2	T	C	10: 112,458,597	C579R	probably damaging	Het
Kdr	T	C	5: 75,951,838	T862A	probably damaging	Het
Kif17	T	C	4: 138,278,245	S182P	possibly damaging	Het
Klf5	A	T	14: 99,301,882	T164S	probably benign	Het
Ksr2	T	G	5: 117,555,294	V269G	possibly damaging	Het
Mcm5	T	A	8: 75,120,911	D445E	probably damaging	Het
Mlkl	T	C	8: 111,327,948	I186V	probably damaging	Het
Muc4	A	T	16: 32,771,604	S3017C	possibly damaging	Het
Myo15	T	C	11: 60,477,850	F479L	possibly damaging	Het
Myo6	A	G	9: 80,273,975		probably benign	Het
Nup98	T	A	7: 102,139,652		probably null	Het
Odf2l	A	G	3: 145,148,541	N383S	probably damaging	Het
Olfml3	A	C	3: 103,737,026		probably null	Het
Olfr1057	A	T	2: 86,374,815	V199E	possibly damaging	Het
Olfr1494	T	A	19: 13,749,988	I294N	probably damaging	Het
Olfr1537	A	G	9: 39,238,011	Y141H	probably benign	Het
Olfr829	G	A	9: 18,856,629	M1I	probably null	Het
Plxna4	A	T	6: 32,197,074	D1195E	probably benign	Het
Ppp1r1a	T	A	15: 103,537,820	H20L	probably damaging	Het
Prdm4	A	G	10: 85,910,221		probably null	Het
Prom2	A	G	2: 127,538,338		probably benign	Het
Rasal3	T	C	17: 32,403,383	M1V	probably null	Het
Rhoj	A	G	12: 75,394,420		probably null	Het
Rnf40	C	T	7: 127,596,860		probably null	Het
Slc15a3	T	C	19: 10,843,250	L77P	probably damaging	Het
Slc26a6	T	C	9: 108,861,323	V586A	possibly damaging	Het
Slc30a10	T	A	1: 185,455,173	L37Q	probably damaging	Het
Slc43a2	T	A	11: 75,563,577	M316K	probably benign	Het
Smarcal1	T	C	1: 72,632,851	F844L	probably benign	Het
Snx19	A	G	9: 30,428,616	E350G	possibly damaging	Het
Tecta	T	A	9: 42,367,228	T995S	probably benign	Het
Tmc3	T	G	7: 83,612,473	N586K	probably damaging	Het
Tmem107	T	A	11: 69,072,413		probably benign	Het
Tmem247	A	G	17: 86,918,561	Q51R	probably benign	Het
Tmpo	G	T	10: 91,164,038		probably benign	Het
Ubr5	T	A	15: 37,996,571	T1894S	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Xirp2	T	A	2: 67,517,124	H3236Q	probably benign	Het
Zfand4	G	A	6: 116,314,739	D545N	probably benign	Het
Zkscan3	G	T	13: 21,394,774	P155T	possibly damaging	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- CCAAAGCCAAGTGCAAGTGTGTG -3'
(R):5'- ACAGGTTCTGTTAGCCCTGAGAGAC -3'

Sequencing Primer
(F):5'- TCATGGGAAGTCAGCTCTAAC -3'
(R):5'- AGAGACAGATCTGCAACTGG -3'

Posted On

2013-04-12