Mutagenetix > Incidental Mutations

Incidental Mutation 'R0133:Dsc3'

21790

Institutional Source

Beutler Lab

Gene Symbol

Dsc3

Ensembl Gene

ENSMUSG00000059898

Gene Name

desmocollin 3

Synonyms

MMRRC Submission

038418-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0133 (G1)

Quality Score

173

Status

Validated (trace)

Chromosome

Chromosomal Location

19960930-20002351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19971582 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 563 (T563A)

Ref Sequence

ENSEMBL: ENSMUSP00000153261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115848
AA Change: T563A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: T563A

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	9.08e-41	SMART
CA	156	241	4.99e-11	SMART
CA	265	353	7.79e-22	SMART
CA	376	471	2.66e-6	SMART
CA	494	576	4.58e-19	SMART
CA	595	677	3.02e-2	SMART
transmembrane domain	692	714	N/A	INTRINSIC
Pfam:Cadherin_C	778	895	1.1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000225110
AA Change: T563A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.5059

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.2%
20x: 89.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	C	11: 103,105,388	S172P	probably damaging	Het
Akap6	A	T	12: 53,139,471	K1223*	probably null	Het
Akna	G	A	4: 63,379,361	Q819*	probably null	Het
Ankrd2	T	C	19: 42,044,071	V257A	probably benign	Het
Arap1	T	A	7: 101,386,229	D30E	probably damaging	Het
Atp6v0d2	T	C	4: 19,910,578		probably benign	Het
Blm	T	A	7: 80,502,367	I611F	possibly damaging	Het
Ccng2	A	G	5: 93,273,381	K250R	probably benign	Het
Cdhr3	A	G	12: 33,092,752	L8P	possibly damaging	Het
Csf2rb	T	G	15: 78,339,004		probably benign	Het
Ctbs	A	G	3: 146,457,468	I204V	probably benign	Het
Cxcl16	T	A	11: 70,458,770	E76D	possibly damaging	Het
Dhx15	T	C	5: 52,154,072	I689V	possibly damaging	Het
Dlk2	T	C	17: 46,298,942		probably benign	Het
Dnah2	A	T	11: 69,421,009	M4452K	probably damaging	Het
Dok4	T	A	8: 94,865,363	I280F	probably benign	Het
Dsg1b	C	T	18: 20,404,878	A617V	probably damaging	Het
Eps8l2	C	T	7: 141,362,207	P721S	unknown	Het
Evx2	T	C	2: 74,659,082	D112G	possibly damaging	Het
Fam124a	C	A	14: 62,606,333	T430K	possibly damaging	Het
Fbrs	C	T	7: 127,489,610		probably benign	Het
Fbxw14	T	C	9: 109,274,579	T22A	probably benign	Het
Fmo5	T	G	3: 97,645,636	V300G	probably damaging	Het
Gadl1	T	C	9: 115,941,343	S75P	probably benign	Het
Galnt2	T	G	8: 124,338,538	I469S	probably benign	Het
Gga3	T	A	11: 115,588,979		probably benign	Het
Gm10647	T	C	9: 66,798,489		probably benign	Het
Gm14180	C	A	11: 99,734,217	C25F	unknown	Het
Grid2	A	T	6: 64,320,132	D493V	probably damaging	Het
Gzmc	T	A	14: 56,232,297	Y182F	possibly damaging	Het
Hecw2	A	C	1: 53,830,740	L1443R	probably damaging	Het
Igkv4-62	A	G	6: 69,400,069	I32T	probably benign	Het
Ikzf1	T	A	11: 11,741,015		probably null	Het
Il27ra	G	A	8: 84,033,942		probably benign	Het
Jmjd1c	C	A	10: 67,240,808	A2137D	probably benign	Het
Kcnc2	T	C	10: 112,458,597	C579R	probably damaging	Het
Kdr	T	C	5: 75,951,838	T862A	probably damaging	Het
Kif17	T	C	4: 138,278,245	S182P	possibly damaging	Het
Klf5	A	T	14: 99,301,882	T164S	probably benign	Het
Ksr2	T	G	5: 117,555,294	V269G	possibly damaging	Het
Mcm5	T	A	8: 75,120,911	D445E	probably damaging	Het
Mlkl	T	C	8: 111,327,948	I186V	probably damaging	Het
Muc4	A	T	16: 32,771,604	S3017C	possibly damaging	Het
Myo15	T	C	11: 60,477,850	F479L	possibly damaging	Het
Myo6	A	G	9: 80,273,975		probably benign	Het
Myom1	T	A	17: 71,047,787	V393E	probably damaging	Het
Nup98	T	A	7: 102,139,652		probably null	Het
Odf2l	A	G	3: 145,148,541	N383S	probably damaging	Het
Olfml3	A	C	3: 103,737,026		probably null	Het
Olfr1057	A	T	2: 86,374,815	V199E	possibly damaging	Het
Olfr1494	T	A	19: 13,749,988	I294N	probably damaging	Het
Olfr1537	A	G	9: 39,238,011	Y141H	probably benign	Het
Olfr829	G	A	9: 18,856,629	M1I	probably null	Het
Plxna4	A	T	6: 32,197,074	D1195E	probably benign	Het
Ppp1r1a	T	A	15: 103,537,820	H20L	probably damaging	Het
Prdm4	A	G	10: 85,910,221		probably null	Het
Prom2	A	G	2: 127,538,338		probably benign	Het
Rasal3	T	C	17: 32,403,383	M1V	probably null	Het
Rhoj	A	G	12: 75,394,420		probably null	Het
Rnf40	C	T	7: 127,596,860		probably null	Het
Slc15a3	T	C	19: 10,843,250	L77P	probably damaging	Het
Slc26a6	T	C	9: 108,861,323	V586A	possibly damaging	Het
Slc30a10	T	A	1: 185,455,173	L37Q	probably damaging	Het
Slc43a2	T	A	11: 75,563,577	M316K	probably benign	Het
Smarcal1	T	C	1: 72,632,851	F844L	probably benign	Het
Snx19	A	G	9: 30,428,616	E350G	possibly damaging	Het
Tecta	T	A	9: 42,367,228	T995S	probably benign	Het
Tmc3	T	G	7: 83,612,473	N586K	probably damaging	Het
Tmem107	T	A	11: 69,072,413		probably benign	Het
Tmem247	A	G	17: 86,918,561	Q51R	probably benign	Het
Tmpo	G	T	10: 91,164,038		probably benign	Het
Ubr5	T	A	15: 37,996,571	T1894S	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Xirp2	T	A	2: 67,517,124	H3236Q	probably benign	Het
Zfand4	G	A	6: 116,314,739	D545N	probably benign	Het
Zkscan3	G	T	13: 21,394,774	P155T	possibly damaging	Het

Other mutations in Dsc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Dsc3	APN	18	19985631	missense	probably null	1.00
IGL01978:Dsc3	APN	18	19974196	missense	possibly damaging	0.79
IGL02101:Dsc3	APN	18	20001906	missense	probably benign	0.01
IGL02165:Dsc3	APN	18	19983652	missense	probably benign	0.06
IGL02543:Dsc3	APN	18	19965828	missense	probably benign	0.11
IGL02970:Dsc3	APN	18	19968260	missense	probably damaging	1.00
IGL03097:Dsc3	UTSW	18	19974048	missense	probably benign	0.30
R0304:Dsc3	UTSW	18	19981241	missense	probably damaging	1.00
R0360:Dsc3	UTSW	18	19971582	missense	possibly damaging	0.79
R0673:Dsc3	UTSW	18	19989590	missense	probably damaging	1.00
R0826:Dsc3	UTSW	18	19981172	missense	probably damaging	0.99
R1120:Dsc3	UTSW	18	19986977	missense	probably benign	0.05
R1491:Dsc3	UTSW	18	19987034	missense	probably damaging	0.99
R1667:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R1688:Dsc3	UTSW	18	19966227	missense	probably damaging	1.00
R1792:Dsc3	UTSW	18	19986998	missense	probably damaging	1.00
R1858:Dsc3	UTSW	18	19965716	missense	probably damaging	0.97
R1965:Dsc3	UTSW	18	19980672	missense	probably damaging	1.00
R1988:Dsc3	UTSW	18	19965846	missense	possibly damaging	0.86
R2049:Dsc3	UTSW	18	19989680	missense	possibly damaging	0.65
R2127:Dsc3	UTSW	18	19968354	missense	probably benign	0.00
R2143:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2144:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2148:Dsc3	UTSW	18	19965638	missense	probably damaging	0.99
R3038:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R3872:Dsc3	UTSW	18	19971508	missense	probably damaging	0.99
R4229:Dsc3	UTSW	18	19965821	missense	probably damaging	1.00
R4298:Dsc3	UTSW	18	19980754	missense	possibly damaging	0.62
R4491:Dsc3	UTSW	18	20001865	missense	probably benign	0.30
R4590:Dsc3	UTSW	18	19989695	missense	probably damaging	1.00
R4615:Dsc3	UTSW	18	19971488	missense	possibly damaging	0.67
R5316:Dsc3	UTSW	18	19963541	missense	possibly damaging	0.67
R5758:Dsc3	UTSW	18	19989534	missense	probably damaging	1.00
R5796:Dsc3	UTSW	18	19971501	missense	probably benign	0.01
R5916:Dsc3	UTSW	18	19987020	missense	probably damaging	1.00
R6022:Dsc3	UTSW	18	19966338	missense	probably damaging	0.97
R6233:Dsc3	UTSW	18	19965795	missense	possibly damaging	0.77
R6351:Dsc3	UTSW	18	19966291	missense	probably benign	0.05
R6971:Dsc3	UTSW	18	19966218	critical splice donor site	probably null
R7261:Dsc3	UTSW	18	19980757	nonsense	probably null
R7442:Dsc3	UTSW	18	19981156	missense	probably damaging	1.00
R7795:Dsc3	UTSW	18	19966231	missense	probably damaging	1.00
R8051:Dsc3	UTSW	18	19981213	missense	probably damaging	1.00
R8531:Dsc3	UTSW	18	19968392	missense	probably benign
R8531:Dsc3	UTSW	18	19981217	missense	probably damaging	1.00
X0061:Dsc3	UTSW	18	19989627	missense	probably damaging	1.00
Z1177:Dsc3	UTSW	18	19966315	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGTTTGCCAAGTTGAACTGAAAGGG -3'
(R):5'- CCGATAGTATCATCAGCAGGAGCCATC -3'

Sequencing Primer
(F):5'- TTGAACTGAAAGGGAGGGC -3'
(R):5'- gcaagaaatggatacaagtggg -3'

Posted On

2013-04-12