Incidental Mutation 'R0133:Dsc3'
ID21790
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Namedesmocollin 3
Synonyms
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0133 (G1)
Quality Score173
Status Validated (trace)
Chromosome18
Chromosomal Location19960930-20002351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19971582 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 563 (T563A)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
Predicted Effect probably damaging
Transcript: ENSMUST00000115848
AA Change: T563A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: T563A

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225110
AA Change: T563A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.5059 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 19985631 missense probably null 1.00
IGL01978:Dsc3 APN 18 19974196 missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20001906 missense probably benign 0.01
IGL02165:Dsc3 APN 18 19983652 missense probably benign 0.06
IGL02543:Dsc3 APN 18 19965828 missense probably benign 0.11
IGL02970:Dsc3 APN 18 19968260 missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 19974048 missense probably benign 0.30
R0304:Dsc3 UTSW 18 19981241 missense probably damaging 1.00
R0360:Dsc3 UTSW 18 19971582 missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 19989590 missense probably damaging 1.00
R0826:Dsc3 UTSW 18 19981172 missense probably damaging 0.99
R1120:Dsc3 UTSW 18 19986977 missense probably benign 0.05
R1491:Dsc3 UTSW 18 19987034 missense probably damaging 0.99
R1667:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 19966227 missense probably damaging 1.00
R1792:Dsc3 UTSW 18 19986998 missense probably damaging 1.00
R1858:Dsc3 UTSW 18 19965716 missense probably damaging 0.97
R1965:Dsc3 UTSW 18 19980672 missense probably damaging 1.00
R1988:Dsc3 UTSW 18 19965846 missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 19989680 missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 19968354 missense probably benign 0.00
R2143:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 19965638 missense probably damaging 0.99
R3038:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 19971508 missense probably damaging 0.99
R4229:Dsc3 UTSW 18 19965821 missense probably damaging 1.00
R4298:Dsc3 UTSW 18 19980754 missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20001865 missense probably benign 0.30
R4590:Dsc3 UTSW 18 19989695 missense probably damaging 1.00
R4615:Dsc3 UTSW 18 19971488 missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 19963541 missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 19989534 missense probably damaging 1.00
R5796:Dsc3 UTSW 18 19971501 missense probably benign 0.01
R5916:Dsc3 UTSW 18 19987020 missense probably damaging 1.00
R6022:Dsc3 UTSW 18 19966338 missense probably damaging 0.97
R6233:Dsc3 UTSW 18 19965795 missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 19966291 missense probably benign 0.05
R6971:Dsc3 UTSW 18 19966218 critical splice donor site probably null
R7261:Dsc3 UTSW 18 19980757 nonsense probably null
R7442:Dsc3 UTSW 18 19981156 missense probably damaging 1.00
R7795:Dsc3 UTSW 18 19966231 missense probably damaging 1.00
X0061:Dsc3 UTSW 18 19989627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTGCCAAGTTGAACTGAAAGGG -3'
(R):5'- CCGATAGTATCATCAGCAGGAGCCATC -3'

Sequencing Primer
(F):5'- TTGAACTGAAAGGGAGGGC -3'
(R):5'- gcaagaaatggatacaagtggg -3'
Posted On2013-04-12