Incidental Mutation 'R1957:Mki67'
ID217917
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 039971-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135698399 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1635 (D1635E)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably benign
Transcript: ENSMUST00000033310
AA Change: D1635E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: D1635E

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
R7578:Mki67 UTSW 7 135700915 missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135699377 missense probably benign 0.01
R7646:Mki67 UTSW 7 135696769 missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135697426 missense probably damaging 1.00
R7691:Mki67 UTSW 7 135701992 missense not run
R7780:Mki67 UTSW 7 135713968 missense probably benign 0.02
R7796:Mki67 UTSW 7 135698194 missense probably damaging 1.00
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTGGTTGTGGAGATCTCAAG -3'
(R):5'- TCTTTGACCACTGGAATCTCAAC -3'

Sequencing Primer
(F):5'- TGTGGAGATCTCAAGGACATTC -3'
(R):5'- CTGGAATCTCAACAATGCTTGC -3'
Posted On2014-08-01