Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Lhx9'

21795

Institutional Source

Beutler Lab

Gene Symbol

Lhx9

Ensembl Gene

ENSMUSG00000019230

Gene Name

LIM homeobox protein 9

Synonyms

3110009O07Rik, Lhx9 alpha, LH2B

MMRRC Submission

038419-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.756) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

138825186-138848577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 138838679 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 124 (C124S)

Ref Sequence

ENSEMBL: ENSMUSP00000107661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019374
AA Change: C133S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: C133S

Domain	Start	End	E-Value	Type
LIM	70	123	4.48e-17	SMART
LIM	132	186	8.04e-19	SMART
HOX	267	319	1.89e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000046870
AA Change: C124S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: C124S

Domain	Start	End	E-Value	Type
LIM	61	114	4.48e-17	SMART
LIM	123	177	8.04e-19	SMART
HOX	258	320	8.07e-22	SMART
low complexity region	344	368	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093486
AA Change: C124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: C124S

Domain	Start	End	E-Value	Type
LIM	61	114	4.48e-17	SMART
LIM	123	177	8.04e-19	SMART
HOX	258	310	1.89e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112026
AA Change: C133S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: C133S

Domain	Start	End	E-Value	Type
LIM	70	123	4.48e-17	SMART
LIM	132	186	8.04e-19	SMART
HOX	267	329	8.07e-22	SMART
low complexity region	353	377	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112030
AA Change: C124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: C124S

Domain	Start	End	E-Value	Type
LIM	61	114	4.48e-17	SMART
LIM	123	177	8.04e-19	SMART
HOX	258	310	1.89e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194557
AA Change: M65K

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.9659

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Lhx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Lhx9	APN	1	138828680	missense	possibly damaging	0.74
IGL01624:Lhx9	APN	1	138832783	nonsense	probably null
IGL02149:Lhx9	APN	1	138831434	missense	probably damaging	1.00
IGL02452:Lhx9	APN	1	138841842	missense	probably damaging	1.00
IGL02982:Lhx9	APN	1	138838611	missense	probably damaging	1.00
R0123:Lhx9	UTSW	1	138838679	missense	probably damaging	1.00
R0141:Lhx9	UTSW	1	138840006	missense	possibly damaging	0.86
R0225:Lhx9	UTSW	1	138838679	missense	probably damaging	1.00
R0281:Lhx9	UTSW	1	138832904	missense	probably benign	0.00
R1460:Lhx9	UTSW	1	138838709	splice site	probably benign
R1932:Lhx9	UTSW	1	138842009	start gained	probably benign
R4738:Lhx9	UTSW	1	138832748	missense	probably damaging	1.00
R4792:Lhx9	UTSW	1	138838351	missense	possibly damaging	0.87
R4820:Lhx9	UTSW	1	138838367	missense	probably benign	0.00
R4877:Lhx9	UTSW	1	138838354	missense	probably benign	0.04
R6035:Lhx9	UTSW	1	138838543	missense	possibly damaging	0.67
R6035:Lhx9	UTSW	1	138838543	missense	possibly damaging	0.67
R6825:Lhx9	UTSW	1	138841806	frame shift	probably null
R6852:Lhx9	UTSW	1	138841806	frame shift	probably null
R6853:Lhx9	UTSW	1	138841806	frame shift	probably null
R7264:Lhx9	UTSW	1	138832751	missense	probably damaging	0.98
R8097:Lhx9	UTSW	1	138838351	missense	probably damaging	0.97
R8164:Lhx9	UTSW	1	138832780	missense	probably damaging	1.00
R8245:Lhx9	UTSW	1	138838441	missense	probably benign	0.24
R8278:Lhx9	UTSW	1	138838586	missense	probably damaging	0.98
Z1177:Lhx9	UTSW	1	138831498	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCATTGAAGTAAGGCAAAGCCAAGC -3'
(R):5'- ATTCACTAGGACCAGAGGAGGTCAC -3'

Sequencing Primer
(F):5'- CAGCTCCGTGTAGCTCAG -3'
(R):5'- TCACCGAGCAAGTAAAGCTG -3'

Posted On

2013-04-12