Incidental Mutation 'R0134:Lhx9'
ID 21795
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock # R0134 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 138825186-138848577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138838679 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 124 (C124S)
Ref Sequence ENSEMBL: ENSMUSP00000107661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably damaging
Transcript: ENSMUST00000019374
AA Change: C133S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: C133S

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046870
AA Change: C124S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: C124S

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093486
AA Change: C124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: C124S

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112026
AA Change: C133S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: C133S

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112030
AA Change: C124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: C124S

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194557
AA Change: M65K

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.9659 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138828680 missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138832783 nonsense probably null
IGL02149:Lhx9 APN 1 138831434 missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138841842 missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138838611 missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0141:Lhx9 UTSW 1 138840006 missense possibly damaging 0.86
R0225:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0281:Lhx9 UTSW 1 138832904 missense probably benign 0.00
R1460:Lhx9 UTSW 1 138838709 splice site probably benign
R1932:Lhx9 UTSW 1 138842009 start gained probably benign
R4738:Lhx9 UTSW 1 138832748 missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138838351 missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138838367 missense probably benign 0.00
R4877:Lhx9 UTSW 1 138838354 missense probably benign 0.04
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138841806 frame shift probably null
R6852:Lhx9 UTSW 1 138841806 frame shift probably null
R6853:Lhx9 UTSW 1 138841806 frame shift probably null
R7264:Lhx9 UTSW 1 138832751 missense probably damaging 0.98
R8097:Lhx9 UTSW 1 138838351 missense probably damaging 0.97
R8164:Lhx9 UTSW 1 138832780 missense probably damaging 1.00
R8245:Lhx9 UTSW 1 138838441 missense probably benign 0.24
R8278:Lhx9 UTSW 1 138838586 missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138841966 missense probably damaging 1.00
Z1177:Lhx9 UTSW 1 138831498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGAAGTAAGGCAAAGCCAAGC -3'
(R):5'- ATTCACTAGGACCAGAGGAGGTCAC -3'

Sequencing Primer
(F):5'- CAGCTCCGTGTAGCTCAG -3'
(R):5'- TCACCGAGCAAGTAAAGCTG -3'
Posted On 2013-04-12