Incidental Mutation 'R1957:Daam1'
ID 217953
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Name dishevelled associated activator of morphogenesis 1
Synonyms 1700066F09Rik, 2310028E21Rik
MMRRC Submission 039971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1957 (G1)
Quality Score 114
Status Validated
Chromosome 12
Chromosomal Location 71831078-71992333 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 71982755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
AlphaFold Q8BPM0
Predicted Effect probably null
Transcript: ENSMUST00000085299
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221317
Predicted Effect probably null
Transcript: ENSMUST00000223272
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8157:Daam1 UTSW 12 71952489 missense probably damaging 1.00
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
R8963:Daam1 UTSW 12 71945244 missense unknown
R9283:Daam1 UTSW 12 71988922 missense probably damaging 1.00
R9402:Daam1 UTSW 12 71959830 missense probably benign 0.09
R9563:Daam1 UTSW 12 71945477 missense unknown
R9696:Daam1 UTSW 12 71944373 missense unknown
R9762:Daam1 UTSW 12 71944081 missense unknown
R9803:Daam1 UTSW 12 71944148 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGCATATGCCTGCCTCC -3'
(R):5'- GAATTGTTGGCCCTCCTCAC -3'

Sequencing Primer
(F):5'- TATGCCTGCCTCCAAGCACG -3'
(R):5'- CTCAGGACACTTGGCTGTATGAAAC -3'
Posted On 2014-08-01