Incidental Mutation 'R1957:Dzip3'
ID217969
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 039971-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48927593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1151 (L1151F)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably damaging
Transcript: ENSMUST00000114516
AA Change: L945F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: L945F

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: L1151F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: L1151F

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147358
Predicted Effect unknown
Transcript: ENSMUST00000151950
AA Change: L143F
SMART Domains Protein: ENSMUSP00000117675
Gene: ENSMUSG00000064061
AA Change: L143F

DomainStartEndE-ValueType
low complexity region 82 90 N/A INTRINSIC
SCOP:d1ldjb_ 113 161 1e-3 SMART
Blast:RING 137 161 4e-10 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48951905 missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48977944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCACAACCATGACTGTATAC -3'
(R):5'- ACAAGGTTCTGCCACATGGG -3'

Sequencing Primer
(F):5'- CCCAGAGTGAAGTGTAGTTATGCCC -3'
(R):5'- CTGCCACATGGGAAGGAGAC -3'
Posted On2014-08-01