Incidental Mutation 'R0134:Garnl3'
ID21798
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R0134 (G1)
Quality Score187
Status Validated (trace)
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33006804 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 608 (T608A)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049618
AA Change: T567A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: T567A

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102810
AA Change: T563A

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: T563A

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137381
AA Change: T608A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193214
Meta Mutation Damage Score 0.7059 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTGAAACTCCTCGTCCTCAAC -3'
(R):5'- GTCCCAACAGGTCATCTCACTTCG -3'

Sequencing Primer
(F):5'- ctcctccctgacctacacc -3'
(R):5'- AACAGGTCATCTCACTTCGCTATC -3'
Posted On2013-04-12