Incidental Mutation 'R1958:Abca14'
ID 218026
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 039972-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1958 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119924382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1678 (Y1678C)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000084640] [ENSMUST00000121265] [ENSMUST00000207220]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000076272
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084640
AA Change: Y1678C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: Y1678C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121265
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140459
Predicted Effect probably benign
Transcript: ENSMUST00000207220
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,457,146 (GRCm39) N155I probably benign Het
Adamts19 A T 18: 59,103,078 (GRCm39) R706S probably benign Het
Adipor1 T C 1: 134,350,771 (GRCm39) S7P probably benign Het
Adss2 A G 1: 177,597,544 (GRCm39) I372T probably damaging Het
Arhgap15 T A 2: 44,133,136 (GRCm39) D347E possibly damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Asb8 T C 15: 98,034,097 (GRCm39) T153A possibly damaging Het
Aspscr1 G T 11: 120,580,034 (GRCm39) G191V probably null Het
Atm T C 9: 53,382,718 (GRCm39) H1957R probably damaging Het
Atp13a5 A G 16: 29,133,419 (GRCm39) Y411H probably damaging Het
Cadm1 T G 9: 47,761,633 (GRCm39) I411S probably damaging Het
Cdh23 T A 10: 60,246,652 (GRCm39) M927L probably benign Het
Cdk15 A T 1: 59,383,475 (GRCm39) R423W probably damaging Het
Cep250 T A 2: 155,818,301 (GRCm39) probably null Het
Cfap43 T A 19: 47,885,649 (GRCm39) Y322F probably benign Het
Cfap54 T C 10: 92,833,204 (GRCm39) S1141G probably benign Het
Clnk T C 5: 38,863,969 (GRCm39) Y428C possibly damaging Het
Cnksr1 A G 4: 133,955,727 (GRCm39) S668P probably benign Het
Cpxm2 A T 7: 131,663,876 (GRCm39) I349N probably damaging Het
Csmd3 A G 15: 47,868,035 (GRCm39) probably null Het
Cstdc3 T C 16: 36,132,927 (GRCm39) L68P possibly damaging Het
Dnmt1 C T 9: 20,838,442 (GRCm39) R207H probably benign Het
Dph2 A T 4: 117,749,041 (GRCm39) F5I probably damaging Het
Dst T A 1: 34,202,802 (GRCm39) F325L probably damaging Het
Edem3 T C 1: 151,680,076 (GRCm39) L474S probably damaging Het
Emilin1 T A 5: 31,075,160 (GRCm39) L467Q probably benign Het
Fam170a G A 18: 50,415,181 (GRCm39) E276K probably benign Het
Farp1 A T 14: 121,456,787 (GRCm39) probably null Het
Fbrs A T 7: 127,085,163 (GRCm39) T584S possibly damaging Het
Fbxo22 T A 9: 55,116,626 (GRCm39) probably null Het
Fhod3 T G 18: 25,223,522 (GRCm39) L956R probably damaging Het
Fmo4 G A 1: 162,631,259 (GRCm39) T236I probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Gdf10 G A 14: 33,654,710 (GRCm39) A406T probably benign Het
Gm11444 A T 11: 85,738,999 (GRCm39) probably benign Het
Gm14443 T C 2: 175,011,497 (GRCm39) I316M probably benign Het
Has3 A T 8: 107,605,435 (GRCm39) Y547F probably benign Het
Hdhd2 A G 18: 77,052,841 (GRCm39) T164A probably benign Het
Hoxb9 T A 11: 96,162,880 (GRCm39) D171E possibly damaging Het
Hpx A G 7: 105,245,603 (GRCm39) Y118H probably damaging Het
Iqsec1 T C 6: 90,647,441 (GRCm39) K858E probably damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Lama2 C A 10: 26,857,594 (GRCm39) R3085L probably damaging Het
Lyst C A 13: 13,791,203 (GRCm39) A22E probably damaging Het
Man2a1 T C 17: 65,057,830 (GRCm39) F1079L probably benign Het
Marco C T 1: 120,412,593 (GRCm39) G303R probably damaging Het
Marveld2 A C 13: 100,733,858 (GRCm39) I536R probably damaging Het
Mcm5 A G 8: 75,848,257 (GRCm39) D502G probably benign Het
Mdga1 A T 17: 30,059,862 (GRCm39) L653Q probably damaging Het
Mical2 A G 7: 111,980,311 (GRCm39) D161G probably benign Het
Mroh2a C T 1: 88,165,213 (GRCm39) R445* probably null Het
Mrpl46 A T 7: 78,431,146 (GRCm39) probably null Het
Nckipsd C A 9: 108,691,863 (GRCm39) probably null Het
Nek11 T C 9: 105,170,916 (GRCm39) D373G probably benign Het
Nle1 G A 11: 82,795,068 (GRCm39) S321F probably benign Het
Noxa1 A G 2: 24,980,620 (GRCm39) S130P probably damaging Het
Or10a5 A G 7: 106,635,478 (GRCm39) T39A possibly damaging Het
Or51v14 T A 7: 103,260,618 (GRCm39) *314L probably null Het
Or5l13 A T 2: 87,779,809 (GRCm39) L256H probably damaging Het
Or8b39 T A 9: 37,996,419 (GRCm39) C96S probably damaging Het
Parp3 T G 9: 106,352,021 (GRCm39) probably null Het
Pask A T 1: 93,249,180 (GRCm39) I740N probably benign Het
Pelp1 A G 11: 70,289,347 (GRCm39) F221S probably damaging Het
Pkd1l1 T G 11: 8,824,161 (GRCm39) K1135Q probably benign Het
Plcl2 A T 17: 50,915,109 (GRCm39) Q706L probably damaging Het
Psg26 T C 7: 18,212,264 (GRCm39) T364A probably benign Het
Ptprb C T 10: 116,177,441 (GRCm39) T1047M probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab37 C T 11: 115,051,177 (GRCm39) A155V probably damaging Het
Rbbp6 A C 7: 122,601,168 (GRCm39) probably benign Het
Rbmxl2 A G 7: 106,809,405 (GRCm39) D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,229,115 (GRCm39) probably benign Het
Sass6 G T 3: 116,403,945 (GRCm39) K194N possibly damaging Het
Sgpp1 T G 12: 75,782,222 (GRCm39) D39A probably benign Het
Shank3 T C 15: 89,387,351 (GRCm39) V198A probably damaging Het
Sin3a T A 9: 57,012,893 (GRCm39) S591T probably damaging Het
Slc12a6 C T 2: 112,185,503 (GRCm39) T924I possibly damaging Het
Sln T A 9: 53,760,785 (GRCm39) I10N probably benign Het
St3gal3 A T 4: 117,797,268 (GRCm39) M309K probably damaging Het
Syne2 T A 12: 76,016,319 (GRCm39) D3301E probably benign Het
Tgtp2 A G 11: 48,949,919 (GRCm39) S218P probably damaging Het
Tha1 C T 11: 117,760,179 (GRCm39) probably benign Het
Tmem102 A G 11: 69,695,225 (GRCm39) V249A probably benign Het
Top3b G A 16: 16,702,166 (GRCm39) E268K possibly damaging Het
Trip4 T C 9: 65,746,307 (GRCm39) S530G possibly damaging Het
Tut1 T A 19: 8,936,677 (GRCm39) V167E probably damaging Het
Tut4 A T 4: 108,412,903 (GRCm39) S1535C probably damaging Het
Ube2u A T 4: 100,338,833 (GRCm39) M33L probably benign Het
Unc79 T C 12: 102,957,621 (GRCm39) I12T probably damaging Het
Unc79 A T 12: 103,041,178 (GRCm39) D737V probably benign Het
Vmn1r26 A G 6: 57,985,286 (GRCm39) V301A probably benign Het
Vmn1r86 A G 7: 12,836,621 (GRCm39) V35A possibly damaging Het
Vmn2r98 A C 17: 19,286,680 (GRCm39) N393H possibly damaging Het
Vps13b T G 15: 35,878,835 (GRCm39) S2945A probably damaging Het
Whrn C T 4: 63,353,666 (GRCm39) R367H possibly damaging Het
Zfp235 A T 7: 23,839,771 (GRCm39) L133F probably damaging Het
Zfp74 T C 7: 29,635,136 (GRCm39) T191A probably benign Het
Zfp943 A T 17: 22,211,979 (GRCm39) K355I probably damaging Het
Zranb1 T G 7: 132,584,458 (GRCm39) S601R probably damaging Het
Zscan29 A T 2: 121,000,289 (GRCm39) probably null Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAACGTTTCAGTGGTAAC -3'
(R):5'- TTCTAGGAGGGAGAACAGGGTATTTC -3'

Sequencing Primer
(F):5'- CAGTGGTAACTGCATGCTTTC -3'
(R):5'- ACTCATCTAAGTCTATAATGAAGGGG -3'
Posted On 2014-08-01