Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Kif16b'

21804

Institutional Source

Beutler Lab

Gene Symbol

Kif16b

Ensembl Gene

ENSMUSG00000038844

Gene Name

kinesin family member 16B

Synonyms

8430434E15Rik, N-3 kinesin

MMRRC Submission

038419-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0134 (G1)

Quality Score

196

Status

Validated (trace)

Chromosome

Chromosomal Location

142617474-142901531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 142672375 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1215 (S1215T)

Ref Sequence

ENSEMBL: ENSMUSP00000154926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000230763]

AlphaFold

B1AVY7

Predicted Effect

probably benign
Transcript: ENSMUST00000043589
AA Change: S1204T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: S1204T

Domain	Start	End	E-Value	Type
KISc	1	366	4.87e-173	SMART
FHA	477	529	1.43e-1	SMART
coiled coil region	597	809	N/A	INTRINSIC
coiled coil region	835	858	N/A	INTRINSIC
coiled coil region	941	1022	N/A	INTRINSIC
PX	1179	1281	1.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230763
AA Change: S1215T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Kif16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kif16b	APN	2	142848035	nonsense	probably null
IGL00499:Kif16b	APN	2	142857324	missense	probably damaging	1.00
IGL00913:Kif16b	APN	2	142704007	nonsense	probably null
IGL00971:Kif16b	APN	2	142711744	missense	probably benign	0.01
IGL01712:Kif16b	APN	2	142648471	missense	probably damaging	1.00
IGL01965:Kif16b	APN	2	142848405	missense	probably damaging	1.00
IGL02428:Kif16b	APN	2	142672360	missense	possibly damaging	0.88
IGL02576:Kif16b	APN	2	142862545	splice site	probably benign
IGL02884:Kif16b	APN	2	142702614	splice site	probably benign
IGL03065:Kif16b	APN	2	142619913	missense	probably damaging	1.00
IGL03103:Kif16b	APN	2	142862488	missense	probably damaging	1.00
IGL03403:Kif16b	APN	2	142711869	missense	probably damaging	1.00
IGL02835:Kif16b	UTSW	2	142712213	missense	probably benign	0.00
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0081:Kif16b	UTSW	2	142707426	splice site	probably benign
R0123:Kif16b	UTSW	2	142672375	missense	probably benign
R0388:Kif16b	UTSW	2	142740937	missense	probably damaging	1.00
R0396:Kif16b	UTSW	2	142853659	missense	probably damaging	1.00
R0502:Kif16b	UTSW	2	142712155	missense	probably benign	0.00
R1027:Kif16b	UTSW	2	142854538	splice site	probably benign
R1674:Kif16b	UTSW	2	142712953	nonsense	probably null
R1752:Kif16b	UTSW	2	142690666	missense	probably benign	0.01
R2154:Kif16b	UTSW	2	142690580	missense	probably damaging	1.00
R2262:Kif16b	UTSW	2	142740917	missense	probably damaging	1.00
R2401:Kif16b	UTSW	2	142756122	missense	probably benign	0.04
R3951:Kif16b	UTSW	2	142707359	missense	probably benign	0.01
R4161:Kif16b	UTSW	2	142707404	missense	probably benign	0.00
R4697:Kif16b	UTSW	2	142690694	missense	probably benign	0.09
R4747:Kif16b	UTSW	2	142857426	missense	probably damaging	1.00
R4808:Kif16b	UTSW	2	142857358	missense	probably damaging	1.00
R4878:Kif16b	UTSW	2	142848003	missense	probably damaging	1.00
R5068:Kif16b	UTSW	2	142711707	missense	probably benign
R5120:Kif16b	UTSW	2	142848339	missense	probably damaging	1.00
R5358:Kif16b	UTSW	2	142740969	missense	probably damaging	1.00
R5821:Kif16b	UTSW	2	142702666	missense	probably damaging	1.00
R5833:Kif16b	UTSW	2	142707367	missense	probably benign
R5882:Kif16b	UTSW	2	142707258	critical splice donor site	probably null
R5974:Kif16b	UTSW	2	142857381	missense	probably damaging	1.00
R6043:Kif16b	UTSW	2	142711900	missense	probably damaging	1.00
R6230:Kif16b	UTSW	2	142849912	missense	probably damaging	1.00
R6373:Kif16b	UTSW	2	142699698	missense	possibly damaging	0.91
R6472:Kif16b	UTSW	2	142699948	intron	probably benign
R6622:Kif16b	UTSW	2	142712442	missense	probably benign	0.01
R6654:Kif16b	UTSW	2	142701277	intron	probably benign
R6912:Kif16b	UTSW	2	142700099	intron	probably benign
R7003:Kif16b	UTSW	2	142758829	missense	possibly damaging	0.95
R7265:Kif16b	UTSW	2	142714730	missense	probably damaging	1.00
R7307:Kif16b	UTSW	2	142712931	missense	probably benign	0.00
R7376:Kif16b	UTSW	2	142711872	missense	probably damaging	0.99
R7381:Kif16b	UTSW	2	142857423	missense	probably damaging	1.00
R7558:Kif16b	UTSW	2	142758826	missense	probably damaging	1.00
R7681:Kif16b	UTSW	2	142756126	missense	probably damaging	1.00
R7896:Kif16b	UTSW	2	142834075	critical splice donor site	probably null
R7956:Kif16b	UTSW	2	142862470	missense	probably benign	0.00
R8053:Kif16b	UTSW	2	142853714	missense	probably damaging	1.00
R8056:Kif16b	UTSW	2	142712842	missense	probably damaging	1.00
R8139:Kif16b	UTSW	2	142901365	missense	probably benign	0.00
R8182:Kif16b	UTSW	2	142712899	missense	possibly damaging	0.90
R8224:Kif16b	UTSW	2	142834088	missense	probably benign	0.03
R8357:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8359:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8360:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8369:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8385:Kif16b	UTSW	2	142712338	missense	probably benign	0.09
R8457:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8720:Kif16b	UTSW	2	142849872	missense	probably damaging	1.00
R8898:Kif16b	UTSW	2	142712979	missense	possibly damaging	0.81
R8987:Kif16b	UTSW	2	142849863	critical splice donor site	probably null
R9022:Kif16b	UTSW	2	142712617	missense	possibly damaging	0.46
R9040:Kif16b	UTSW	2	142849878	missense	probably benign	0.02
R9044:Kif16b	UTSW	2	142699657	missense	possibly damaging	0.91
X0058:Kif16b	UTSW	2	142758861	missense	probably damaging	1.00
Z1177:Kif16b	UTSW	2	142711824	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCTAATGCCATCAGCTCAGTTTCC -3'
(R):5'- AGAGGTAATCTTCTGGTCCTAGCTTTCC -3'

Sequencing Primer
(F):5'- CAGTTTCCTTATAAAATGTGCGCTC -3'
(R):5'- GACATACAAGACATGGCTGC -3'

Posted On

2013-04-12