Mutagenetix > Incidental Mutation

Incidental Mutation 'R1958:Cfap54'

218049

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

039972-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1958 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92997342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1141 (S1141G)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000168110
AA Change: S1141G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: S1141G

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170065

Predicted Effect

probably benign
Transcript: ENSMUST00000212902
AA Change: S1141G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

97% (99/102)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	T	4: 62,538,909	N155I	probably benign	Het
Abca14	A	G	7: 120,325,159	Y1678C	probably damaging	Het
Adamts19	A	T	18: 58,970,006	R706S	probably benign	Het
Adipor1	T	C	1: 134,423,033	S7P	probably benign	Het
Adss	A	G	1: 177,769,978	I372T	probably damaging	Het
Arhgap15	T	A	2: 44,243,124	D347E	possibly damaging	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
Asb8	T	C	15: 98,136,216	T153A	possibly damaging	Het
Aspscr1	G	T	11: 120,689,208	G191V	probably null	Het
Atm	T	C	9: 53,471,418	H1957R	probably damaging	Het
Atp13a5	A	G	16: 29,314,601	Y411H	probably damaging	Het
Cadm1	T	G	9: 47,850,335	I411S	probably damaging	Het
Cdh23	T	A	10: 60,410,873	M927L	probably benign	Het
Cdk15	A	T	1: 59,344,316	R423W	probably damaging	Het
Cep250	T	A	2: 155,976,381		probably null	Het
Cfap43	T	A	19: 47,897,210	Y322F	probably benign	Het
Clnk	T	C	5: 38,706,626	Y428C	possibly damaging	Het
Cnksr1	A	G	4: 134,228,416	S668P	probably benign	Het
Cpxm2	A	T	7: 132,062,147	I349N	probably damaging	Het
Csmd3	A	G	15: 48,004,639		probably null	Het
Dnmt1	C	T	9: 20,927,146	R207H	probably benign	Het
Dph2	A	T	4: 117,891,844	F5I	probably damaging	Het
Dst	T	A	1: 34,163,721	F325L	probably damaging	Het
Edem3	T	C	1: 151,804,325	L474S	probably damaging	Het
Emilin1	T	A	5: 30,917,816	L467Q	probably benign	Het
Fam170a	G	A	18: 50,282,114	E276K	probably benign	Het
Farp1	A	T	14: 121,219,375		probably null	Het
Fbrs	A	T	7: 127,485,991	T584S	possibly damaging	Het
Fbxo22	T	A	9: 55,209,342		probably null	Het
Fhod3	T	G	18: 25,090,465	L956R	probably damaging	Het
Fmo4	G	A	1: 162,803,690	T236I	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Gdf10	G	A	14: 33,932,753	A406T	probably benign	Het
Gm11444	A	T	11: 85,848,173		probably benign	Het
Gm14443	T	C	2: 175,169,704	I316M	probably benign	Het
Gm4758	T	C	16: 36,312,565	L68P	possibly damaging	Het
Has3	A	T	8: 106,878,803	Y547F	probably benign	Het
Hdhd2	A	G	18: 76,965,145	T164A	probably benign	Het
Hoxb9	T	A	11: 96,272,054	D171E	possibly damaging	Het
Hpx	A	G	7: 105,596,396	Y118H	probably damaging	Het
Iqsec1	T	C	6: 90,670,459	K858E	probably damaging	Het
Kifc1	G	A	17: 33,884,711	R195C	probably benign	Het
Lama2	C	A	10: 26,981,598	R3085L	probably damaging	Het
Lyst	C	A	13: 13,616,618	A22E	probably damaging	Het
Man2a1	T	C	17: 64,750,835	F1079L	probably benign	Het
Marco	C	T	1: 120,484,864	G303R	probably damaging	Het
Marveld2	A	C	13: 100,597,350	I536R	probably damaging	Het
Mcm5	A	G	8: 75,121,629	D502G	probably benign	Het
Mdga1	A	T	17: 29,840,888	L653Q	probably damaging	Het
Micalcl	A	G	7: 112,381,104	D161G	probably benign	Het
Mroh2a	C	T	1: 88,237,491	R445*	probably null	Het
Mrpl46	A	T	7: 78,781,398		probably null	Het
Nckipsd	C	A	9: 108,814,664		probably null	Het
Nek11	T	C	9: 105,293,717	D373G	probably benign	Het
Nle1	G	A	11: 82,904,242	S321F	probably benign	Het
Noxa1	A	G	2: 25,090,608	S130P	probably damaging	Het
Olfr1156	A	T	2: 87,949,465	L256H	probably damaging	Het
Olfr620	T	A	7: 103,611,411	*314L	probably null	Het
Olfr713	A	G	7: 107,036,271	T39A	possibly damaging	Het
Olfr887	T	A	9: 38,085,123	C96S	probably damaging	Het
Parp3	T	G	9: 106,474,822		probably null	Het
Pask	A	T	1: 93,321,458	I740N	probably benign	Het
Pelp1	A	G	11: 70,398,521	F221S	probably damaging	Het
Pkd1l1	T	G	11: 8,874,161	K1135Q	probably benign	Het
Plcl2	A	T	17: 50,608,081	Q706L	probably damaging	Het
Psg26	T	C	7: 18,478,339	T364A	probably benign	Het
Ptprb	C	T	10: 116,341,536	T1047M	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab37	C	T	11: 115,160,351	A155V	probably damaging	Het
Rbbp6	A	C	7: 123,001,945		probably benign	Het
Rbmxl2	A	G	7: 107,210,198	D230G	probably benign	Het
Rsf1	CGGCGGCGGCGGCGGCGGCGGCGGCGGC	CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,908		probably benign	Het
Sass6	G	T	3: 116,610,296	K194N	possibly damaging	Het
Sgpp1	T	G	12: 75,735,448	D39A	probably benign	Het
Shank3	T	C	15: 89,503,148	V198A	probably damaging	Het
Sin3a	T	A	9: 57,105,609	S591T	probably damaging	Het
Slc12a6	C	T	2: 112,355,158	T924I	possibly damaging	Het
Sln	T	A	9: 53,853,501	I10N	probably benign	Het
St3gal3	A	T	4: 117,940,071	M309K	probably damaging	Het
Syne2	T	A	12: 75,969,545	D3301E	probably benign	Het
Tgtp2	A	G	11: 49,059,092	S218P	probably damaging	Het
Tha1	C	T	11: 117,869,353		probably benign	Het
Tmem102	A	G	11: 69,804,399	V249A	probably benign	Het
Top3b	G	A	16: 16,884,302	E268K	possibly damaging	Het
Trip4	T	C	9: 65,839,025	S530G	possibly damaging	Het
Tut1	T	A	19: 8,959,313	V167E	probably damaging	Het
Ube2u	A	T	4: 100,481,636	M33L	probably benign	Het
Unc79	A	T	12: 103,074,919	D737V	probably benign	Het
Unc79	T	C	12: 102,991,362	I12T	probably damaging	Het
Vmn1r26	A	G	6: 58,008,301	V301A	probably benign	Het
Vmn1r86	A	G	7: 13,102,694	V35A	possibly damaging	Het
Vmn2r98	A	C	17: 19,066,418	N393H	possibly damaging	Het
Vps13b	T	G	15: 35,878,689	S2945A	probably damaging	Het
Whrn	C	T	4: 63,435,429	R367H	possibly damaging	Het
Zcchc11	A	T	4: 108,555,706	S1535C	probably damaging	Het
Zfp235	A	T	7: 24,140,346	L133F	probably damaging	Het
Zfp74	T	C	7: 29,935,711	T191A	probably benign	Het
Zfp943	A	T	17: 21,992,998	K355I	probably damaging	Het
Zranb1	T	G	7: 132,982,729	S601R	probably damaging	Het
Zscan29	A	T	2: 121,169,808		probably null	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTCCACTGAACTCCTGAAG -3'
(R):5'- TCATGTTGTTGAGCCAGAGG -3'

Sequencing Primer
(F):5'- TACAGAGGCTATGCTGCTCC -3'
(R):5'- TTGAGCCAGAGGGTTAACATCCC -3'

Posted On

2014-08-01