Incidental Mutation 'R0134:Nlgn1'
ID21805
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
MMRRC Submission 038419-MU
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0134 (G1)
Quality Score183
Status Validated (trace)
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25435925 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 546 (C546Y)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure
Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075054
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: C546Y

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108308
AA Change: C517Y

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: C517Y

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191835
AA Change: C517Y

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: C517Y

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193603
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: C546Y

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0123:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1952:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4190:Nlgn1 UTSW 3 25433898 missense probably benign
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 unclassified probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
R7754:Nlgn1 UTSW 3 25434303 missense probably damaging 1.00
R7886:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
R7969:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCCATGCAGCTCAGAATC -3'
(R):5'- CAGACCTTCACTCGAACTTTGGCTC -3'

Sequencing Primer
(F):5'- GCAGGTAACGTAACAACTGTTC -3'
(R):5'- GAACTTTGGCTCACCTACATAC -3'
Posted On2013-04-12