Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Siah2'

21806

Institutional Source

Beutler Lab

Gene Symbol

Siah2

Ensembl Gene

ENSMUSG00000036432

Gene Name

siah E3 ubiquitin protein ligase 2

Synonyms

Sinh2

MMRRC Submission

038419-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

58674938-58692400 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58676115 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 250 (V250A)

Ref Sequence

ENSEMBL: ENSMUSP00000067496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070368]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070368
AA Change: V250A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000067496
Gene: ENSMUSG00000036432
AA Change: V250A

Domain	Start	End	E-Value	Type
low complexity region	18	70	N/A	INTRINSIC
RING	81	115	6.18e-1	SMART
Pfam:Sina	123	319	6.5e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145032

Meta Mutation Damage Score

0.5823

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in regulating cellular response to hypoxia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Siah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02410:Siah2	APN	3	58676047	missense	probably damaging	1.00
R0021:Siah2	UTSW	3	58676292	missense	probably benign	0.00
R0021:Siah2	UTSW	3	58676292	missense	probably benign	0.00
R0123:Siah2	UTSW	3	58676115	missense	probably damaging	0.98
R0564:Siah2	UTSW	3	58676235	missense	probably benign	0.32
R0648:Siah2	UTSW	3	58676214	missense	probably damaging	0.99
R1164:Siah2	UTSW	3	58676316	missense	probably benign	0.43
R1387:Siah2	UTSW	3	58691514	missense	possibly damaging	0.95
R1955:Siah2	UTSW	3	58676097	missense	probably damaging	0.99
R3732:Siah2	UTSW	3	58676250	missense	probably damaging	1.00
R3732:Siah2	UTSW	3	58676250	missense	probably damaging	1.00
R3733:Siah2	UTSW	3	58676250	missense	probably damaging	1.00
R5704:Siah2	UTSW	3	58676400	missense	probably damaging	1.00
R6738:Siah2	UTSW	3	58691553	missense	probably benign	0.37
R6821:Siah2	UTSW	3	58691770	missense	probably benign	0.23
R8356:Siah2	UTSW	3	58676082	missense	probably benign	0.20
R8456:Siah2	UTSW	3	58676082	missense	probably benign	0.20
Z1177:Siah2	UTSW	3	58691620	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGCTATGCCCAAATAACTTCCCAGG -3'
(R):5'- AAGCTGTGATGTCCCATCTCATGC -3'

Sequencing Primer
(F):5'- CTGACAGCATGTAGATATCGTGAC -3'
(R):5'- CATGCCCACAAGAGTATCACTAC -3'

Posted On

2013-04-12