Mutagenetix > Incidental Mutation

Incidental Mutation 'R1959:Sec16a'

218103

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

039973-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R1959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26430132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1431 (H1431Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably benign
Transcript: ENSMUST00000091252
AA Change: H1431Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: H1431Q

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114082
AA Change: H1431Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: H1431Q

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156442

SMART Domains

Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

Domain	Start	End	E-Value	Type
Pfam:Sec16	14	114	7.7e-11	PFAM
low complexity region	150	164	N/A	INTRINSIC
Pfam:Sec16_C	186	438	1.6e-45	PFAM
low complexity region	659	674	N/A	INTRINSIC
low complexity region	715	727	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	777	792	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Anapc1	C	A	2: 128,633,415	R1381S	probably benign	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Fsip2	A	G	2: 82,991,550	K5876E	probably benign	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Lama2	G	T	10: 27,422,618	P161T	probably damaging	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pkd1l2	A	T	8: 117,043,231		probably null	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Sox5	A	G	6: 143,874,105	S62P	possibly damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
R9506:Sec16a	UTSW	2	26429372	critical splice donor site	probably null
R9581:Sec16a	UTSW	2	26438635	missense
R9772:Sec16a	UTSW	2	26439405	missense	possibly damaging	0.87
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCAATCCAAGGGCCAATATTG -3'
(R):5'- TGTCTCTGCCTAGGACCAAC -3'

Sequencing Primer
(F):5'- TGGCCTGTACCAATAAGCC -3'
(R):5'- TCTGCCTAGGACCAACAGTGTAC -3'

Posted On

2014-08-01