Incidental Mutation 'R1959:Sec16a'
ID218103
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26430132 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1431 (H1431Q)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably benign
Transcript: ENSMUST00000091252
AA Change: H1431Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: H1431Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
AA Change: H1431Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: H1431Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCAATCCAAGGGCCAATATTG -3'
(R):5'- TGTCTCTGCCTAGGACCAAC -3'

Sequencing Primer
(F):5'- TGGCCTGTACCAATAAGCC -3'
(R):5'- TCTGCCTAGGACCAACAGTGTAC -3'
Posted On2014-08-01