Mutagenetix > Incidental Mutation

Incidental Mutation 'R1959:Anapc1'

218113

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

039973-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128633415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1381 (R1381S)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

probably benign
Transcript: ENSMUST00000014499
AA Change: R1381S

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: R1381S

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154995

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Fsip2	A	G	2: 82,991,550	K5876E	probably benign	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Lama2	G	T	10: 27,422,618	P161T	probably damaging	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pkd1l2	A	T	8: 117,043,231		probably null	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Sec16a	A	T	2: 26,430,132	H1431Q	probably benign	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Sox5	A	G	6: 143,874,105	S62P	possibly damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGGCTAAAGTAAACCCTTTCGTG -3'
(R):5'- GAATGTATGTCAGCTGATATTGGAG -3'

Sequencing Primer
(F):5'- GCTAAAGTAAACCCTTTCGTGGAAAG -3'
(R):5'- TTGGAGATATTTCAACGAACAAGGC -3'

Posted On

2014-08-01