Incidental Mutation 'R0134:Slc9a1'
ID 21812
Institutional Source Beutler Lab
Gene Symbol Slc9a1
Ensembl Gene ENSMUSG00000028854
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 1
Synonyms Apnh, Nhe1, antiporter
MMRRC Submission 038419-MU
Accession Numbers

Genbank: NM_016981; MGI: 102462

Essential gene? Non essential (E-score: 0.000) question?
Stock # R0134 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 133369706-133423702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133420605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 645 (K645E)
Ref Sequence ENSEMBL: ENSMUSP00000030669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030669]
AlphaFold Q61165
Predicted Effect probably benign
Transcript: ENSMUST00000030669
AA Change: K645E

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854
AA Change: K645E

DomainStartEndE-ValueType
transmembrane domain 15 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 109 509 1.3e-89 PFAM
Pfam:NEXCaM_BD 603 704 1.5e-34 PFAM
low complexity region 757 764 N/A INTRINSIC
low complexity region 803 814 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156079
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Slc9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc9a1 APN 4 133370548 missense probably benign 0.03
IGL00949:Slc9a1 APN 4 133416451 missense probably benign 0.03
IGL00952:Slc9a1 APN 4 133416382 missense probably damaging 0.99
IGL01023:Slc9a1 APN 4 133422143 missense probably benign 0.04
IGL01151:Slc9a1 APN 4 133411989 missense probably damaging 1.00
IGL01796:Slc9a1 APN 4 133420093 splice site probably benign
IGL01896:Slc9a1 APN 4 133418059 missense probably damaging 1.00
IGL02621:Slc9a1 APN 4 133370568 missense probably benign
F6893:Slc9a1 UTSW 4 133422146 missense probably benign 0.06
R0123:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0225:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0658:Slc9a1 UTSW 4 133420499 splice site probably benign
R0759:Slc9a1 UTSW 4 133416403 missense probably damaging 1.00
R0781:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1110:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1316:Slc9a1 UTSW 4 133422247 missense possibly damaging 0.95
R1637:Slc9a1 UTSW 4 133422223 missense probably benign
R1680:Slc9a1 UTSW 4 133418080 missense probably damaging 1.00
R2050:Slc9a1 UTSW 4 133416334 missense probably benign 0.02
R4279:Slc9a1 UTSW 4 133412089 missense probably benign 0.31
R4960:Slc9a1 UTSW 4 133370656 missense probably damaging 1.00
R5381:Slc9a1 UTSW 4 133422071 missense probably damaging 0.96
R5590:Slc9a1 UTSW 4 133421563 missense probably damaging 0.99
R5638:Slc9a1 UTSW 4 133412260 missense probably damaging 1.00
R5935:Slc9a1 UTSW 4 133419865 intron probably benign
R6334:Slc9a1 UTSW 4 133422208 missense possibly damaging 0.64
R6402:Slc9a1 UTSW 4 133370651 missense probably benign 0.37
R7553:Slc9a1 UTSW 4 133412269 missense probably damaging 1.00
R7772:Slc9a1 UTSW 4 133411965 missense probably damaging 1.00
R7843:Slc9a1 UTSW 4 133370442 start gained probably benign
R8268:Slc9a1 UTSW 4 133370623 missense probably benign 0.08
R8359:Slc9a1 UTSW 4 133420616 missense probably damaging 1.00
R8398:Slc9a1 UTSW 4 133419503 missense probably benign 0.05
R8887:Slc9a1 UTSW 4 133411947 missense probably benign
R9310:Slc9a1 UTSW 4 133416370 missense probably damaging 1.00
X0018:Slc9a1 UTSW 4 133418071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACTTGGGACATTGGCAACC -3'
(R):5'- GTGTGTCTGTTATAGGACCGCAGC -3'

Sequencing Primer
(F):5'- TTGGCAACCCACCCCTG -3'
(R):5'- CTGAGGGGGGAACAGCC -3'
Posted On 2013-04-12