Mutagenetix > Incidental Mutation

Incidental Mutation 'R0134:Slc9a1'

21812

Institutional Source

Beutler Lab

Gene Symbol

Slc9a1

Ensembl Gene

ENSMUSG00000028854

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 1

Synonyms

Apnh, Nhe1, antiporter

MMRRC Submission

038419-MU

Accession Numbers

Genbank: NM_016981; MGI: 102462

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

133369706-133423702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133420605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 645 (K645E)

Ref Sequence

ENSEMBL: ENSMUSP00000030669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030669]

AlphaFold

Q61165

Predicted Effect

probably benign
Transcript: ENSMUST00000030669
AA Change: K645E

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854
AA Change: K645E

Domain	Start	End	E-Value	Type
transmembrane domain	15	33	N/A	INTRINSIC
Pfam:Na_H_Exchanger	109	509	1.3e-89	PFAM
Pfam:NEXCaM_BD	603	704	1.5e-34	PFAM
low complexity region	757	764	N/A	INTRINSIC
low complexity region	803	814	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141658

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156079

Meta Mutation Damage Score

0.1026

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Slc9a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Slc9a1	APN	4	133370548	missense	probably benign	0.03
IGL00949:Slc9a1	APN	4	133416451	missense	probably benign	0.03
IGL00952:Slc9a1	APN	4	133416382	missense	probably damaging	0.99
IGL01023:Slc9a1	APN	4	133422143	missense	probably benign	0.04
IGL01151:Slc9a1	APN	4	133411989	missense	probably damaging	1.00
IGL01796:Slc9a1	APN	4	133420093	splice site	probably benign
IGL01896:Slc9a1	APN	4	133418059	missense	probably damaging	1.00
IGL02621:Slc9a1	APN	4	133370568	missense	probably benign
F6893:Slc9a1	UTSW	4	133422146	missense	probably benign	0.06
R0123:Slc9a1	UTSW	4	133420605	missense	probably benign	0.34
R0225:Slc9a1	UTSW	4	133420605	missense	probably benign	0.34
R0658:Slc9a1	UTSW	4	133420499	splice site	probably benign
R0759:Slc9a1	UTSW	4	133416403	missense	probably damaging	1.00
R0781:Slc9a1	UTSW	4	133370548	missense	probably benign	0.03
R1110:Slc9a1	UTSW	4	133370548	missense	probably benign	0.03
R1316:Slc9a1	UTSW	4	133422247	missense	possibly damaging	0.95
R1637:Slc9a1	UTSW	4	133422223	missense	probably benign
R1680:Slc9a1	UTSW	4	133418080	missense	probably damaging	1.00
R2050:Slc9a1	UTSW	4	133416334	missense	probably benign	0.02
R4279:Slc9a1	UTSW	4	133412089	missense	probably benign	0.31
R4960:Slc9a1	UTSW	4	133370656	missense	probably damaging	1.00
R5381:Slc9a1	UTSW	4	133422071	missense	probably damaging	0.96
R5590:Slc9a1	UTSW	4	133421563	missense	probably damaging	0.99
R5638:Slc9a1	UTSW	4	133412260	missense	probably damaging	1.00
R5935:Slc9a1	UTSW	4	133419865	intron	probably benign
R6334:Slc9a1	UTSW	4	133422208	missense	possibly damaging	0.64
R6402:Slc9a1	UTSW	4	133370651	missense	probably benign	0.37
R7553:Slc9a1	UTSW	4	133412269	missense	probably damaging	1.00
R7772:Slc9a1	UTSW	4	133411965	missense	probably damaging	1.00
R7843:Slc9a1	UTSW	4	133370442	start gained	probably benign
R8268:Slc9a1	UTSW	4	133370623	missense	probably benign	0.08
R8359:Slc9a1	UTSW	4	133420616	missense	probably damaging	1.00
R8398:Slc9a1	UTSW	4	133419503	missense	probably benign	0.05
R8887:Slc9a1	UTSW	4	133411947	missense	probably benign
R9310:Slc9a1	UTSW	4	133416370	missense	probably damaging	1.00
X0018:Slc9a1	UTSW	4	133418071	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGACTTGGGACATTGGCAACC -3'
(R):5'- GTGTGTCTGTTATAGGACCGCAGC -3'

Sequencing Primer
(F):5'- TTGGCAACCCACCCCTG -3'
(R):5'- CTGAGGGGGGAACAGCC -3'

Posted On

2013-04-12