Incidental Mutation 'R1959:Ltbp4'
ID218149
Institutional Source Beutler Lab
Gene Symbol Ltbp4
Ensembl Gene ENSMUSG00000040488
Gene Namelatent transforming growth factor beta binding protein 4
Synonyms2310046A13Rik
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27305136-27337692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27329018 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 273 (P273L)
Ref Sequence ENSEMBL: ENSMUSP00000113674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175]
Predicted Effect unknown
Transcript: ENSMUST00000038618
AA Change: P339L
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: P339L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108369
AA Change: P338L
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: P338L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118583
AA Change: P273L
SMART Domains Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: P273L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 2.3e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 2.2e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 7.1e-15 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118961
AA Change: P273L
SMART Domains Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488
AA Change: P273L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 1.6e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121175
AA Change: P273L
SMART Domains Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: P273L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 3.4e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 3.3e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 1e-14 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
EGF_CA 1550 1594 9.54e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206413
Meta Mutation Damage Score 0.1680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Ltbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ltbp4 APN 7 27328805 missense probably damaging 0.96
IGL00585:Ltbp4 APN 7 27326733 missense probably damaging 0.98
IGL01320:Ltbp4 APN 7 27328359 splice site probably benign
IGL01860:Ltbp4 APN 7 27319646 missense probably damaging 1.00
IGL02026:Ltbp4 APN 7 27327417 nonsense probably null
IGL02226:Ltbp4 APN 7 27306934 missense probably damaging 1.00
IGL02422:Ltbp4 APN 7 27319672 missense probably damaging 1.00
IGL02611:Ltbp4 APN 7 27310655 missense probably damaging 1.00
IGL02892:Ltbp4 APN 7 27310649 missense probably damaging 1.00
IGL02926:Ltbp4 APN 7 27328872 splice site probably null
IGL02950:Ltbp4 APN 7 27306718 missense probably damaging 0.99
IGL03008:Ltbp4 APN 7 27324364 missense probably damaging 0.99
IGL03271:Ltbp4 APN 7 27329815 missense unknown
IGL02837:Ltbp4 UTSW 7 27314381 missense probably damaging 1.00
R0792:Ltbp4 UTSW 7 27325060 missense probably damaging 1.00
R0980:Ltbp4 UTSW 7 27324162 missense probably damaging 1.00
R1017:Ltbp4 UTSW 7 27306076 missense possibly damaging 0.95
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1448:Ltbp4 UTSW 7 27306577 missense possibly damaging 0.86
R1575:Ltbp4 UTSW 7 27322820 missense probably damaging 1.00
R1918:Ltbp4 UTSW 7 27337569 unclassified probably benign
R1932:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R1960:Ltbp4 UTSW 7 27329018 missense unknown
R1976:Ltbp4 UTSW 7 27326770 missense probably damaging 1.00
R2060:Ltbp4 UTSW 7 27308953 missense probably damaging 1.00
R2333:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R2431:Ltbp4 UTSW 7 27319676 missense possibly damaging 0.91
R3125:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R4093:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4095:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4592:Ltbp4 UTSW 7 27325183 missense probably damaging 0.96
R4610:Ltbp4 UTSW 7 27306700 missense probably damaging 1.00
R4650:Ltbp4 UTSW 7 27314309 missense probably damaging 1.00
R4912:Ltbp4 UTSW 7 27306116 nonsense probably null
R5002:Ltbp4 UTSW 7 27327685 frame shift probably null
R5016:Ltbp4 UTSW 7 27327685 frame shift probably null
R5216:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5218:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327321 missense probably benign 0.01
R5539:Ltbp4 UTSW 7 27327724 missense probably damaging 0.97
R5991:Ltbp4 UTSW 7 27309316 missense probably damaging 1.00
R6082:Ltbp4 UTSW 7 27335680 unclassified probably benign
R6125:Ltbp4 UTSW 7 27327755 missense probably damaging 1.00
R6146:Ltbp4 UTSW 7 27319724 missense probably damaging 0.99
R6156:Ltbp4 UTSW 7 27330162 missense unknown
R6414:Ltbp4 UTSW 7 27310715 missense probably damaging 1.00
R6563:Ltbp4 UTSW 7 27309063 missense probably damaging 1.00
R6719:Ltbp4 UTSW 7 27328763 missense probably damaging 0.99
R6940:Ltbp4 UTSW 7 27308944 missense probably damaging 1.00
R7054:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R7116:Ltbp4 UTSW 7 27305427 missense probably damaging 0.99
R7326:Ltbp4 UTSW 7 27329755 missense unknown
R7419:Ltbp4 UTSW 7 27329767 missense unknown
X0025:Ltbp4 UTSW 7 27325802 missense probably damaging 1.00
X0066:Ltbp4 UTSW 7 27306065 critical splice donor site probably null
Z1088:Ltbp4 UTSW 7 27307792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGTGGCTCACAGATG -3'
(R):5'- TCGTGCATTTCGAGAGCCTC -3'

Sequencing Primer
(F):5'- TCACAGATGCAGCTGCTG -3'
(R):5'- GAGAGCCTCCGATCTTACTTACTGAG -3'
Posted On2014-08-01