Incidental Mutation 'R1959:Shank1'
ID 218152
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene Name SH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 039973-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R1959 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 43959677-44009996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43974801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 377 (N377I)
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
AlphaFold D3YZU1
Predicted Effect unknown
Transcript: ENSMUST00000107934
AA Change: N377I
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: N377I

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107935
AA Change: N377I
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: N377I

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: N377I
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: N377I

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Aco1 T C 4: 40,167,193 (GRCm39) probably null Het
Adap1 A G 5: 139,259,096 (GRCm39) Y364H probably benign Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgb A T 10: 10,270,993 (GRCm39) D883E probably benign Het
Anapc1 C A 2: 128,475,335 (GRCm39) R1381S probably benign Het
Aoah A G 13: 20,978,564 (GRCm39) M1V probably null Het
Arap1 C A 7: 101,022,222 (GRCm39) A8E probably damaging Het
Arhgap10 A G 8: 78,136,255 (GRCm39) F319S possibly damaging Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cabin1 A T 10: 75,570,924 (GRCm39) V784E possibly damaging Het
Card9 T A 2: 26,244,885 (GRCm39) probably null Het
Cdk18 A G 1: 132,045,559 (GRCm39) I238T possibly damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Commd3 A T 2: 18,678,774 (GRCm39) I70F probably benign Het
Cspg5 G A 9: 110,080,094 (GRCm39) V340M probably damaging Het
Cyb5r4 G A 9: 86,937,902 (GRCm39) S307N possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Ddx11 A G 17: 66,437,723 (GRCm39) M150V probably benign Het
Dennd4b A G 3: 90,176,080 (GRCm39) Y190C probably damaging Het
Det1 A G 7: 78,493,191 (GRCm39) V271A probably benign Het
Dgkd C A 1: 87,857,549 (GRCm39) P754T possibly damaging Het
Dhx36 T C 3: 62,386,806 (GRCm39) S649G probably benign Het
Dlgap5 A G 14: 47,653,843 (GRCm39) I62T possibly damaging Het
Dmgdh A G 13: 93,857,067 (GRCm39) M724V probably benign Het
Dnah7a A G 1: 53,724,142 (GRCm39) S108P probably benign Het
Dock4 A T 12: 40,760,797 (GRCm39) K495M probably damaging Het
Dse A G 10: 34,036,202 (GRCm39) Y225H probably damaging Het
Emx1 G A 6: 85,180,916 (GRCm39) R211K probably damaging Het
Ergic2 A G 6: 148,100,852 (GRCm39) probably null Het
Fbxo27 G A 7: 28,397,797 (GRCm39) C277Y possibly damaging Het
Fcrl1 T C 3: 87,283,827 (GRCm39) I9T possibly damaging Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Flacc1 A T 1: 58,698,437 (GRCm39) V327D possibly damaging Het
Flnb C T 14: 7,884,735 (GRCm38) Q445* probably null Het
Flrt2 G A 12: 95,747,074 (GRCm39) V471I probably benign Het
Frmd4a G A 2: 4,539,997 (GRCm39) V210M probably damaging Het
Fsip2 A G 2: 82,821,894 (GRCm39) K5876E probably benign Het
Galnt10 T C 11: 57,656,443 (GRCm39) L209P probably damaging Het
Gata5 A T 2: 179,968,729 (GRCm39) S382T possibly damaging Het
Glt6d1 C A 2: 25,684,425 (GRCm39) V194L probably damaging Het
Gm10803 T G 2: 93,394,288 (GRCm39) V20G unknown Het
Gm44511 T G 6: 128,797,234 (GRCm39) T52P probably damaging Het
Gpat4 A T 8: 23,672,952 (GRCm39) L88Q possibly damaging Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Hivep2 A T 10: 14,008,453 (GRCm39) I1684F probably benign Het
Hmcn1 T C 1: 150,525,427 (GRCm39) T3366A probably benign Het
Hnmt A G 2: 23,893,894 (GRCm39) V200A possibly damaging Het
Hps6 A T 19: 45,992,774 (GRCm39) H237L probably benign Het
Hspg2 C T 4: 137,292,206 (GRCm39) P4033S probably damaging Het
Ift70b C T 2: 75,767,443 (GRCm39) E437K probably benign Het
Irf9 T A 14: 55,845,174 (GRCm39) S297T possibly damaging Het
Kdm3b T C 18: 34,945,448 (GRCm39) V753A possibly damaging Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Krtap4-16 A G 11: 99,742,373 (GRCm39) V9A unknown Het
Lama2 G T 10: 27,298,614 (GRCm39) P161T probably damaging Het
Ltbp4 G A 7: 27,028,443 (GRCm39) P273L unknown Het
Lvrn T A 18: 47,027,784 (GRCm39) S866R probably damaging Het
Med13 A G 11: 86,189,805 (GRCm39) Y1035H probably damaging Het
Mertk T A 2: 128,601,010 (GRCm39) N331K probably damaging Het
Mios T A 6: 8,215,437 (GRCm39) F211Y probably benign Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Mphosph9 A T 5: 124,453,764 (GRCm39) S183T possibly damaging Het
Mrto4 A T 4: 139,076,949 (GRCm39) I56N probably damaging Het
Muc5b T C 7: 141,416,374 (GRCm39) C3107R possibly damaging Het
Ncoa2 A G 1: 13,230,476 (GRCm39) Y1023H probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Nr2f1 T C 13: 78,337,935 (GRCm39) T237A probably damaging Het
Nup205 C A 6: 35,210,301 (GRCm39) Q1621K probably benign Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Nxpe2 T A 9: 48,231,026 (GRCm39) S448C probably benign Het
Ogdh T A 11: 6,296,638 (GRCm39) C498S possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or14a256 A T 7: 86,265,639 (GRCm39) F71L probably benign Het
Or2ag15 T C 7: 106,340,601 (GRCm39) E180G probably damaging Het
Or2d2 A T 7: 106,727,717 (GRCm39) D294E possibly damaging Het
Or5ak24 T C 2: 85,260,963 (GRCm39) D70G probably damaging Het
Or5d46 T C 2: 88,170,545 (GRCm39) L212P probably damaging Het
Or6p1 A T 1: 174,258,471 (GRCm39) K159M probably damaging Het
Or8s8 T C 15: 98,354,634 (GRCm39) S148P probably damaging Het
Pcdhb9 T A 18: 37,536,369 (GRCm39) Y788N probably damaging Het
Pcsk5 T C 19: 17,410,782 (GRCm39) D1870G unknown Het
Pde6g A G 11: 120,338,962 (GRCm39) L76P probably damaging Het
Peak1 A T 9: 56,114,073 (GRCm39) Y593N probably damaging Het
Pfas C T 11: 68,885,110 (GRCm39) G16R probably damaging Het
Pkd1l2 A T 8: 117,769,970 (GRCm39) probably null Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Ptpru T A 4: 131,530,788 (GRCm39) I489F probably damaging Het
Rere T G 4: 150,553,247 (GRCm39) H146Q probably benign Het
Rundc1 A T 11: 101,322,322 (GRCm39) Q272L probably damaging Het
Scml4 T C 10: 42,832,017 (GRCm39) L305P probably damaging Het
Sec16a A T 2: 26,320,144 (GRCm39) H1431Q probably benign Het
Serpina1a G A 12: 103,820,059 (GRCm39) Q373* probably null Het
Shc2 T C 10: 79,462,625 (GRCm39) probably null Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc7a2 A T 8: 41,368,002 (GRCm39) I589F probably damaging Het
Smim8 C T 4: 34,771,316 (GRCm39) R26Q probably damaging Het
Smox C A 2: 131,362,384 (GRCm39) A221D probably damaging Het
Sox5 A G 6: 143,819,831 (GRCm39) S62P possibly damaging Het
Spg21 A C 9: 65,391,774 (GRCm39) K240N probably damaging Het
Sv2c C T 13: 96,113,153 (GRCm39) V599M probably damaging Het
Tanc2 T A 11: 105,801,121 (GRCm39) H1112Q probably damaging Het
Tbata T C 10: 61,011,623 (GRCm39) I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 (GRCm39) Y842S probably benign Het
Tctn1 A T 5: 122,379,903 (GRCm39) probably null Het
Tenm1 T C X: 41,916,078 (GRCm39) D402G probably benign Het
Tfcp2l1 T C 1: 118,597,119 (GRCm39) V400A probably benign Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Top2a T C 11: 98,886,803 (GRCm39) probably null Het
Traf7 C A 17: 24,732,255 (GRCm39) G191C probably damaging Het
Trpm1 T A 7: 63,879,978 (GRCm39) L661Q probably damaging Het
Ttn T C 2: 76,580,967 (GRCm39) I23309V probably benign Het
Usp50 T C 2: 126,619,881 (GRCm39) K199E possibly damaging Het
Vmn1r218 T C 13: 23,320,683 (GRCm39) F10S probably damaging Het
Vmn2r89 C A 14: 51,694,897 (GRCm39) T459K probably benign Het
Vps13a T G 19: 16,655,302 (GRCm39) S1909R possibly damaging Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Vwa8 A G 14: 79,219,800 (GRCm39) H516R possibly damaging Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Zfat G C 15: 68,018,392 (GRCm39) P974R probably benign Het
Zfc3h1 T A 10: 115,259,158 (GRCm39) I1601K probably benign Het
Zfp239 A G 6: 117,848,778 (GRCm39) K172R probably benign Het
Zfp335 C T 2: 164,736,722 (GRCm39) G971D probably damaging Het
Zfp532 A T 18: 65,757,563 (GRCm39) I499F probably damaging Het
Zfp647 T C 15: 76,795,314 (GRCm39) T449A possibly damaging Het
Zfp938 C T 10: 82,061,465 (GRCm39) G385D probably damaging Het
Zfp959 T G 17: 56,204,404 (GRCm39) V147G probably damaging Het
Znfx1 A T 2: 166,892,270 (GRCm39) C649S probably damaging Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44,003,662 (GRCm39) missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44,003,660 (GRCm39) missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44,002,547 (GRCm39) missense possibly damaging 0.93
IGL01347:Shank1 APN 7 43,991,544 (GRCm39) missense unknown
IGL01621:Shank1 APN 7 44,001,023 (GRCm39) missense unknown
IGL01621:Shank1 APN 7 43,991,889 (GRCm39) missense unknown
IGL01964:Shank1 APN 7 43,975,102 (GRCm39) missense unknown
IGL02309:Shank1 APN 7 43,962,266 (GRCm39) missense unknown
IGL02325:Shank1 APN 7 43,976,504 (GRCm39) nonsense probably null
IGL02387:Shank1 APN 7 44,006,361 (GRCm39) missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44,003,897 (GRCm39) missense possibly damaging 0.59
R0098:Shank1 UTSW 7 43,962,709 (GRCm39) missense unknown
R0098:Shank1 UTSW 7 43,962,709 (GRCm39) missense unknown
R0197:Shank1 UTSW 7 44,001,718 (GRCm39) missense unknown
R0326:Shank1 UTSW 7 43,968,594 (GRCm39) missense unknown
R0365:Shank1 UTSW 7 44,003,401 (GRCm39) missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44,001,718 (GRCm39) missense unknown
R1033:Shank1 UTSW 7 44,006,220 (GRCm39) missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44,006,462 (GRCm39) missense probably damaging 1.00
R1453:Shank1 UTSW 7 43,965,499 (GRCm39) missense unknown
R1594:Shank1 UTSW 7 43,976,647 (GRCm39) nonsense probably null
R1713:Shank1 UTSW 7 43,969,161 (GRCm39) missense unknown
R1783:Shank1 UTSW 7 44,002,161 (GRCm39) missense possibly damaging 0.70
R1869:Shank1 UTSW 7 43,991,539 (GRCm39) nonsense probably null
R1870:Shank1 UTSW 7 43,991,539 (GRCm39) nonsense probably null
R1962:Shank1 UTSW 7 43,993,747 (GRCm39) critical splice donor site probably null
R2406:Shank1 UTSW 7 44,006,376 (GRCm39) missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44,001,547 (GRCm39) missense unknown
R2509:Shank1 UTSW 7 44,001,148 (GRCm39) missense unknown
R3877:Shank1 UTSW 7 43,994,416 (GRCm39) missense unknown
R4041:Shank1 UTSW 7 43,991,586 (GRCm39) missense unknown
R4249:Shank1 UTSW 7 43,969,160 (GRCm39) missense unknown
R4303:Shank1 UTSW 7 43,991,898 (GRCm39) missense unknown
R4431:Shank1 UTSW 7 43,969,076 (GRCm39) nonsense probably null
R4525:Shank1 UTSW 7 44,004,014 (GRCm39) missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44,004,014 (GRCm39) missense possibly damaging 0.77
R4642:Shank1 UTSW 7 43,962,565 (GRCm39) missense unknown
R4722:Shank1 UTSW 7 43,962,638 (GRCm39) nonsense probably null
R4805:Shank1 UTSW 7 43,993,135 (GRCm39) missense unknown
R4874:Shank1 UTSW 7 43,965,497 (GRCm39) missense unknown
R4904:Shank1 UTSW 7 43,983,464 (GRCm39) intron probably benign
R4939:Shank1 UTSW 7 43,975,586 (GRCm39) missense unknown
R5394:Shank1 UTSW 7 44,002,075 (GRCm39) missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44,001,246 (GRCm39) missense unknown
R5556:Shank1 UTSW 7 43,993,739 (GRCm39) intron probably benign
R5620:Shank1 UTSW 7 43,962,160 (GRCm39) missense unknown
R5656:Shank1 UTSW 7 44,002,310 (GRCm39) missense probably benign 0.33
R5688:Shank1 UTSW 7 44,003,911 (GRCm39) missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44,003,164 (GRCm39) missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44,006,240 (GRCm39) missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44,006,630 (GRCm39) missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44,001,990 (GRCm39) missense probably benign 0.18
R6245:Shank1 UTSW 7 44,001,677 (GRCm39) missense unknown
R6500:Shank1 UTSW 7 43,976,645 (GRCm39) missense unknown
R6602:Shank1 UTSW 7 44,001,760 (GRCm39) missense probably benign 0.03
R6655:Shank1 UTSW 7 43,976,644 (GRCm39) missense unknown
R6709:Shank1 UTSW 7 44,003,600 (GRCm39) missense probably benign 0.43
R6734:Shank1 UTSW 7 44,003,110 (GRCm39) missense probably benign 0.01
R6881:Shank1 UTSW 7 44,001,217 (GRCm39) missense unknown
R6902:Shank1 UTSW 7 44,006,239 (GRCm39) missense probably benign 0.39
R6975:Shank1 UTSW 7 43,962,530 (GRCm39) splice site probably null
R6985:Shank1 UTSW 7 43,994,337 (GRCm39) missense unknown
R7072:Shank1 UTSW 7 43,994,370 (GRCm39) missense unknown
R7116:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7117:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7199:Shank1 UTSW 7 44,002,564 (GRCm39) missense possibly damaging 0.86
R7249:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7252:Shank1 UTSW 7 43,976,585 (GRCm39) missense unknown
R7552:Shank1 UTSW 7 44,002,452 (GRCm39) missense probably benign 0.00
R7653:Shank1 UTSW 7 43,969,093 (GRCm39) missense unknown
R7707:Shank1 UTSW 7 43,993,725 (GRCm39) missense unknown
R7801:Shank1 UTSW 7 44,001,022 (GRCm39) missense unknown
R7804:Shank1 UTSW 7 43,962,308 (GRCm39) missense unknown
R8122:Shank1 UTSW 7 43,983,015 (GRCm39) missense unknown
R8178:Shank1 UTSW 7 43,962,748 (GRCm39) critical splice donor site probably null
R8339:Shank1 UTSW 7 43,975,589 (GRCm39) missense unknown
R8463:Shank1 UTSW 7 44,003,605 (GRCm39) missense possibly damaging 0.77
R9005:Shank1 UTSW 7 44,002,409 (GRCm39) missense probably benign 0.00
R9023:Shank1 UTSW 7 43,968,531 (GRCm39) missense unknown
R9225:Shank1 UTSW 7 43,983,470 (GRCm39) missense unknown
R9234:Shank1 UTSW 7 43,962,579 (GRCm39) missense unknown
R9369:Shank1 UTSW 7 44,001,478 (GRCm39) missense unknown
R9432:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9433:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9434:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9467:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9474:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9475:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9476:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9477:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9519:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9544:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9545:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9598:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9633:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9698:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9699:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9701:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9755:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9783:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9784:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9800:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9802:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
R9803:Shank1 UTSW 7 43,962,342 (GRCm39) missense unknown
X0019:Shank1 UTSW 7 44,006,352 (GRCm39) missense probably damaging 1.00
X0065:Shank1 UTSW 7 44,001,353 (GRCm39) missense unknown
Z1088:Shank1 UTSW 7 44,001,590 (GRCm39) missense unknown
Z1177:Shank1 UTSW 7 43,975,068 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGAATGACCTGCCTTGTCGAG -3'
(R):5'- ACAGGTGGCATCTTGAACC -3'

Sequencing Primer
(F):5'- CCTTGTCGAGGGGCTGCTG -3'
(R):5'- GGTGGCATCTTGAACCCCTCTATC -3'
Posted On 2014-08-01