Incidental Mutation 'R1959:Trpm1'
ID 218153
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 039973-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1959 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63879978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 661 (L661Q)
Ref Sequence ENSEMBL: ENSMUSP00000146140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000205348] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: L777Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L777Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107525
AA Change: L777Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: L777Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138074
AA Change: L201Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138609
AA Change: C79S
Predicted Effect probably benign
Transcript: ENSMUST00000205348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: L661Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: L777Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Meta Mutation Damage Score 0.4440 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Aco1 T C 4: 40,167,193 (GRCm39) probably null Het
Adap1 A G 5: 139,259,096 (GRCm39) Y364H probably benign Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgb A T 10: 10,270,993 (GRCm39) D883E probably benign Het
Anapc1 C A 2: 128,475,335 (GRCm39) R1381S probably benign Het
Aoah A G 13: 20,978,564 (GRCm39) M1V probably null Het
Arap1 C A 7: 101,022,222 (GRCm39) A8E probably damaging Het
Arhgap10 A G 8: 78,136,255 (GRCm39) F319S possibly damaging Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cabin1 A T 10: 75,570,924 (GRCm39) V784E possibly damaging Het
Card9 T A 2: 26,244,885 (GRCm39) probably null Het
Cdk18 A G 1: 132,045,559 (GRCm39) I238T possibly damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Commd3 A T 2: 18,678,774 (GRCm39) I70F probably benign Het
Cspg5 G A 9: 110,080,094 (GRCm39) V340M probably damaging Het
Cyb5r4 G A 9: 86,937,902 (GRCm39) S307N possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Ddx11 A G 17: 66,437,723 (GRCm39) M150V probably benign Het
Dennd4b A G 3: 90,176,080 (GRCm39) Y190C probably damaging Het
Det1 A G 7: 78,493,191 (GRCm39) V271A probably benign Het
Dgkd C A 1: 87,857,549 (GRCm39) P754T possibly damaging Het
Dhx36 T C 3: 62,386,806 (GRCm39) S649G probably benign Het
Dlgap5 A G 14: 47,653,843 (GRCm39) I62T possibly damaging Het
Dmgdh A G 13: 93,857,067 (GRCm39) M724V probably benign Het
Dnah7a A G 1: 53,724,142 (GRCm39) S108P probably benign Het
Dock4 A T 12: 40,760,797 (GRCm39) K495M probably damaging Het
Dse A G 10: 34,036,202 (GRCm39) Y225H probably damaging Het
Emx1 G A 6: 85,180,916 (GRCm39) R211K probably damaging Het
Ergic2 A G 6: 148,100,852 (GRCm39) probably null Het
Fbxo27 G A 7: 28,397,797 (GRCm39) C277Y possibly damaging Het
Fcrl1 T C 3: 87,283,827 (GRCm39) I9T possibly damaging Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Flacc1 A T 1: 58,698,437 (GRCm39) V327D possibly damaging Het
Flnb C T 14: 7,884,735 (GRCm38) Q445* probably null Het
Flrt2 G A 12: 95,747,074 (GRCm39) V471I probably benign Het
Frmd4a G A 2: 4,539,997 (GRCm39) V210M probably damaging Het
Fsip2 A G 2: 82,821,894 (GRCm39) K5876E probably benign Het
Galnt10 T C 11: 57,656,443 (GRCm39) L209P probably damaging Het
Gata5 A T 2: 179,968,729 (GRCm39) S382T possibly damaging Het
Glt6d1 C A 2: 25,684,425 (GRCm39) V194L probably damaging Het
Gm10803 T G 2: 93,394,288 (GRCm39) V20G unknown Het
Gm44511 T G 6: 128,797,234 (GRCm39) T52P probably damaging Het
Gpat4 A T 8: 23,672,952 (GRCm39) L88Q possibly damaging Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Hivep2 A T 10: 14,008,453 (GRCm39) I1684F probably benign Het
Hmcn1 T C 1: 150,525,427 (GRCm39) T3366A probably benign Het
Hnmt A G 2: 23,893,894 (GRCm39) V200A possibly damaging Het
Hps6 A T 19: 45,992,774 (GRCm39) H237L probably benign Het
Hspg2 C T 4: 137,292,206 (GRCm39) P4033S probably damaging Het
Ift70b C T 2: 75,767,443 (GRCm39) E437K probably benign Het
Irf9 T A 14: 55,845,174 (GRCm39) S297T possibly damaging Het
Kdm3b T C 18: 34,945,448 (GRCm39) V753A possibly damaging Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Krtap4-16 A G 11: 99,742,373 (GRCm39) V9A unknown Het
Lama2 G T 10: 27,298,614 (GRCm39) P161T probably damaging Het
Ltbp4 G A 7: 27,028,443 (GRCm39) P273L unknown Het
Lvrn T A 18: 47,027,784 (GRCm39) S866R probably damaging Het
Med13 A G 11: 86,189,805 (GRCm39) Y1035H probably damaging Het
Mertk T A 2: 128,601,010 (GRCm39) N331K probably damaging Het
Mios T A 6: 8,215,437 (GRCm39) F211Y probably benign Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Mphosph9 A T 5: 124,453,764 (GRCm39) S183T possibly damaging Het
Mrto4 A T 4: 139,076,949 (GRCm39) I56N probably damaging Het
Muc5b T C 7: 141,416,374 (GRCm39) C3107R possibly damaging Het
Ncoa2 A G 1: 13,230,476 (GRCm39) Y1023H probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Nr2f1 T C 13: 78,337,935 (GRCm39) T237A probably damaging Het
Nup205 C A 6: 35,210,301 (GRCm39) Q1621K probably benign Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Nxpe2 T A 9: 48,231,026 (GRCm39) S448C probably benign Het
Ogdh T A 11: 6,296,638 (GRCm39) C498S possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or14a256 A T 7: 86,265,639 (GRCm39) F71L probably benign Het
Or2ag15 T C 7: 106,340,601 (GRCm39) E180G probably damaging Het
Or2d2 A T 7: 106,727,717 (GRCm39) D294E possibly damaging Het
Or5ak24 T C 2: 85,260,963 (GRCm39) D70G probably damaging Het
Or5d46 T C 2: 88,170,545 (GRCm39) L212P probably damaging Het
Or6p1 A T 1: 174,258,471 (GRCm39) K159M probably damaging Het
Or8s8 T C 15: 98,354,634 (GRCm39) S148P probably damaging Het
Pcdhb9 T A 18: 37,536,369 (GRCm39) Y788N probably damaging Het
Pcsk5 T C 19: 17,410,782 (GRCm39) D1870G unknown Het
Pde6g A G 11: 120,338,962 (GRCm39) L76P probably damaging Het
Peak1 A T 9: 56,114,073 (GRCm39) Y593N probably damaging Het
Pfas C T 11: 68,885,110 (GRCm39) G16R probably damaging Het
Pkd1l2 A T 8: 117,769,970 (GRCm39) probably null Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Ptpru T A 4: 131,530,788 (GRCm39) I489F probably damaging Het
Rere T G 4: 150,553,247 (GRCm39) H146Q probably benign Het
Rundc1 A T 11: 101,322,322 (GRCm39) Q272L probably damaging Het
Scml4 T C 10: 42,832,017 (GRCm39) L305P probably damaging Het
Sec16a A T 2: 26,320,144 (GRCm39) H1431Q probably benign Het
Serpina1a G A 12: 103,820,059 (GRCm39) Q373* probably null Het
Shank1 A T 7: 43,974,801 (GRCm39) N377I unknown Het
Shc2 T C 10: 79,462,625 (GRCm39) probably null Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc7a2 A T 8: 41,368,002 (GRCm39) I589F probably damaging Het
Smim8 C T 4: 34,771,316 (GRCm39) R26Q probably damaging Het
Smox C A 2: 131,362,384 (GRCm39) A221D probably damaging Het
Sox5 A G 6: 143,819,831 (GRCm39) S62P possibly damaging Het
Spg21 A C 9: 65,391,774 (GRCm39) K240N probably damaging Het
Sv2c C T 13: 96,113,153 (GRCm39) V599M probably damaging Het
Tanc2 T A 11: 105,801,121 (GRCm39) H1112Q probably damaging Het
Tbata T C 10: 61,011,623 (GRCm39) I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 (GRCm39) Y842S probably benign Het
Tctn1 A T 5: 122,379,903 (GRCm39) probably null Het
Tenm1 T C X: 41,916,078 (GRCm39) D402G probably benign Het
Tfcp2l1 T C 1: 118,597,119 (GRCm39) V400A probably benign Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Top2a T C 11: 98,886,803 (GRCm39) probably null Het
Traf7 C A 17: 24,732,255 (GRCm39) G191C probably damaging Het
Ttn T C 2: 76,580,967 (GRCm39) I23309V probably benign Het
Usp50 T C 2: 126,619,881 (GRCm39) K199E possibly damaging Het
Vmn1r218 T C 13: 23,320,683 (GRCm39) F10S probably damaging Het
Vmn2r89 C A 14: 51,694,897 (GRCm39) T459K probably benign Het
Vps13a T G 19: 16,655,302 (GRCm39) S1909R possibly damaging Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Vwa8 A G 14: 79,219,800 (GRCm39) H516R possibly damaging Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Zfat G C 15: 68,018,392 (GRCm39) P974R probably benign Het
Zfc3h1 T A 10: 115,259,158 (GRCm39) I1601K probably benign Het
Zfp239 A G 6: 117,848,778 (GRCm39) K172R probably benign Het
Zfp335 C T 2: 164,736,722 (GRCm39) G971D probably damaging Het
Zfp532 A T 18: 65,757,563 (GRCm39) I499F probably damaging Het
Zfp647 T C 15: 76,795,314 (GRCm39) T449A possibly damaging Het
Zfp938 C T 10: 82,061,465 (GRCm39) G385D probably damaging Het
Zfp959 T G 17: 56,204,404 (GRCm39) V147G probably damaging Het
Znfx1 A T 2: 166,892,270 (GRCm39) C649S probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGATTTTGGCCAGCTCGCTG -3'
(R):5'- GCTGCTCAGAATGCAATTTACAAC -3'

Sequencing Primer
(F):5'- CTGTGGAGCTGTTAGACCAGTCTTAC -3'
(R):5'- TGCAATTTACAACTCAAGCAAGGG -3'
Posted On 2014-08-01