Incidental Mutation 'R1959:Arap1'
ID 218156
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms Centd2, 2410002L19Rik
MMRRC Submission 039973-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1959 (G1)
Quality Score 105
Status Not validated
Chromosome 7
Chromosomal Location 100997296-101061793 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101022222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 8 (A8E)
Ref Sequence ENSEMBL: ENSMUSP00000102624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084896] [ENSMUST00000107010] [ENSMUST00000133423] [ENSMUST00000137384] [ENSMUST00000138628]
AlphaFold Q4LDD4
Predicted Effect probably damaging
Transcript: ENSMUST00000084896
AA Change: A8E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: A8E

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107010
AA Change: A8E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: A8E

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133423
AA Change: A8E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121431
Gene: ENSMUSG00000032812
AA Change: A8E

DomainStartEndE-ValueType
Pfam:SAM_1 5 57 8e-11 PFAM
Pfam:SAM_2 5 57 6.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137384
AA Change: A8E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118657
Gene: ENSMUSG00000032812
AA Change: A8E

DomainStartEndE-ValueType
Pfam:SAM_1 5 54 3.7e-8 PFAM
Pfam:SAM_2 5 54 1.2e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138628
AA Change: A8E
Meta Mutation Damage Score 0.2156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Aco1 T C 4: 40,167,193 (GRCm39) probably null Het
Adap1 A G 5: 139,259,096 (GRCm39) Y364H probably benign Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgb A T 10: 10,270,993 (GRCm39) D883E probably benign Het
Anapc1 C A 2: 128,475,335 (GRCm39) R1381S probably benign Het
Aoah A G 13: 20,978,564 (GRCm39) M1V probably null Het
Arhgap10 A G 8: 78,136,255 (GRCm39) F319S possibly damaging Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cabin1 A T 10: 75,570,924 (GRCm39) V784E possibly damaging Het
Card9 T A 2: 26,244,885 (GRCm39) probably null Het
Cdk18 A G 1: 132,045,559 (GRCm39) I238T possibly damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Commd3 A T 2: 18,678,774 (GRCm39) I70F probably benign Het
Cspg5 G A 9: 110,080,094 (GRCm39) V340M probably damaging Het
Cyb5r4 G A 9: 86,937,902 (GRCm39) S307N possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Ddx11 A G 17: 66,437,723 (GRCm39) M150V probably benign Het
Dennd4b A G 3: 90,176,080 (GRCm39) Y190C probably damaging Het
Det1 A G 7: 78,493,191 (GRCm39) V271A probably benign Het
Dgkd C A 1: 87,857,549 (GRCm39) P754T possibly damaging Het
Dhx36 T C 3: 62,386,806 (GRCm39) S649G probably benign Het
Dlgap5 A G 14: 47,653,843 (GRCm39) I62T possibly damaging Het
Dmgdh A G 13: 93,857,067 (GRCm39) M724V probably benign Het
Dnah7a A G 1: 53,724,142 (GRCm39) S108P probably benign Het
Dock4 A T 12: 40,760,797 (GRCm39) K495M probably damaging Het
Dse A G 10: 34,036,202 (GRCm39) Y225H probably damaging Het
Emx1 G A 6: 85,180,916 (GRCm39) R211K probably damaging Het
Ergic2 A G 6: 148,100,852 (GRCm39) probably null Het
Fbxo27 G A 7: 28,397,797 (GRCm39) C277Y possibly damaging Het
Fcrl1 T C 3: 87,283,827 (GRCm39) I9T possibly damaging Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Flacc1 A T 1: 58,698,437 (GRCm39) V327D possibly damaging Het
Flnb C T 14: 7,884,735 (GRCm38) Q445* probably null Het
Flrt2 G A 12: 95,747,074 (GRCm39) V471I probably benign Het
Frmd4a G A 2: 4,539,997 (GRCm39) V210M probably damaging Het
Fsip2 A G 2: 82,821,894 (GRCm39) K5876E probably benign Het
Galnt10 T C 11: 57,656,443 (GRCm39) L209P probably damaging Het
Gata5 A T 2: 179,968,729 (GRCm39) S382T possibly damaging Het
Glt6d1 C A 2: 25,684,425 (GRCm39) V194L probably damaging Het
Gm10803 T G 2: 93,394,288 (GRCm39) V20G unknown Het
Gm44511 T G 6: 128,797,234 (GRCm39) T52P probably damaging Het
Gpat4 A T 8: 23,672,952 (GRCm39) L88Q possibly damaging Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Hivep2 A T 10: 14,008,453 (GRCm39) I1684F probably benign Het
Hmcn1 T C 1: 150,525,427 (GRCm39) T3366A probably benign Het
Hnmt A G 2: 23,893,894 (GRCm39) V200A possibly damaging Het
Hps6 A T 19: 45,992,774 (GRCm39) H237L probably benign Het
Hspg2 C T 4: 137,292,206 (GRCm39) P4033S probably damaging Het
Ift70b C T 2: 75,767,443 (GRCm39) E437K probably benign Het
Irf9 T A 14: 55,845,174 (GRCm39) S297T possibly damaging Het
Kdm3b T C 18: 34,945,448 (GRCm39) V753A possibly damaging Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Krtap4-16 A G 11: 99,742,373 (GRCm39) V9A unknown Het
Lama2 G T 10: 27,298,614 (GRCm39) P161T probably damaging Het
Ltbp4 G A 7: 27,028,443 (GRCm39) P273L unknown Het
Lvrn T A 18: 47,027,784 (GRCm39) S866R probably damaging Het
Med13 A G 11: 86,189,805 (GRCm39) Y1035H probably damaging Het
Mertk T A 2: 128,601,010 (GRCm39) N331K probably damaging Het
Mios T A 6: 8,215,437 (GRCm39) F211Y probably benign Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Mphosph9 A T 5: 124,453,764 (GRCm39) S183T possibly damaging Het
Mrto4 A T 4: 139,076,949 (GRCm39) I56N probably damaging Het
Muc5b T C 7: 141,416,374 (GRCm39) C3107R possibly damaging Het
Ncoa2 A G 1: 13,230,476 (GRCm39) Y1023H probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Nr2f1 T C 13: 78,337,935 (GRCm39) T237A probably damaging Het
Nup205 C A 6: 35,210,301 (GRCm39) Q1621K probably benign Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Nxpe2 T A 9: 48,231,026 (GRCm39) S448C probably benign Het
Ogdh T A 11: 6,296,638 (GRCm39) C498S possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or14a256 A T 7: 86,265,639 (GRCm39) F71L probably benign Het
Or2ag15 T C 7: 106,340,601 (GRCm39) E180G probably damaging Het
Or2d2 A T 7: 106,727,717 (GRCm39) D294E possibly damaging Het
Or5ak24 T C 2: 85,260,963 (GRCm39) D70G probably damaging Het
Or5d46 T C 2: 88,170,545 (GRCm39) L212P probably damaging Het
Or6p1 A T 1: 174,258,471 (GRCm39) K159M probably damaging Het
Or8s8 T C 15: 98,354,634 (GRCm39) S148P probably damaging Het
Pcdhb9 T A 18: 37,536,369 (GRCm39) Y788N probably damaging Het
Pcsk5 T C 19: 17,410,782 (GRCm39) D1870G unknown Het
Pde6g A G 11: 120,338,962 (GRCm39) L76P probably damaging Het
Peak1 A T 9: 56,114,073 (GRCm39) Y593N probably damaging Het
Pfas C T 11: 68,885,110 (GRCm39) G16R probably damaging Het
Pkd1l2 A T 8: 117,769,970 (GRCm39) probably null Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Ptpru T A 4: 131,530,788 (GRCm39) I489F probably damaging Het
Rere T G 4: 150,553,247 (GRCm39) H146Q probably benign Het
Rundc1 A T 11: 101,322,322 (GRCm39) Q272L probably damaging Het
Scml4 T C 10: 42,832,017 (GRCm39) L305P probably damaging Het
Sec16a A T 2: 26,320,144 (GRCm39) H1431Q probably benign Het
Serpina1a G A 12: 103,820,059 (GRCm39) Q373* probably null Het
Shank1 A T 7: 43,974,801 (GRCm39) N377I unknown Het
Shc2 T C 10: 79,462,625 (GRCm39) probably null Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc7a2 A T 8: 41,368,002 (GRCm39) I589F probably damaging Het
Smim8 C T 4: 34,771,316 (GRCm39) R26Q probably damaging Het
Smox C A 2: 131,362,384 (GRCm39) A221D probably damaging Het
Sox5 A G 6: 143,819,831 (GRCm39) S62P possibly damaging Het
Spg21 A C 9: 65,391,774 (GRCm39) K240N probably damaging Het
Sv2c C T 13: 96,113,153 (GRCm39) V599M probably damaging Het
Tanc2 T A 11: 105,801,121 (GRCm39) H1112Q probably damaging Het
Tbata T C 10: 61,011,623 (GRCm39) I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 (GRCm39) Y842S probably benign Het
Tctn1 A T 5: 122,379,903 (GRCm39) probably null Het
Tenm1 T C X: 41,916,078 (GRCm39) D402G probably benign Het
Tfcp2l1 T C 1: 118,597,119 (GRCm39) V400A probably benign Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Top2a T C 11: 98,886,803 (GRCm39) probably null Het
Traf7 C A 17: 24,732,255 (GRCm39) G191C probably damaging Het
Trpm1 T A 7: 63,879,978 (GRCm39) L661Q probably damaging Het
Ttn T C 2: 76,580,967 (GRCm39) I23309V probably benign Het
Usp50 T C 2: 126,619,881 (GRCm39) K199E possibly damaging Het
Vmn1r218 T C 13: 23,320,683 (GRCm39) F10S probably damaging Het
Vmn2r89 C A 14: 51,694,897 (GRCm39) T459K probably benign Het
Vps13a T G 19: 16,655,302 (GRCm39) S1909R possibly damaging Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Vwa8 A G 14: 79,219,800 (GRCm39) H516R possibly damaging Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Zfat G C 15: 68,018,392 (GRCm39) P974R probably benign Het
Zfc3h1 T A 10: 115,259,158 (GRCm39) I1601K probably benign Het
Zfp239 A G 6: 117,848,778 (GRCm39) K172R probably benign Het
Zfp335 C T 2: 164,736,722 (GRCm39) G971D probably damaging Het
Zfp532 A T 18: 65,757,563 (GRCm39) I499F probably damaging Het
Zfp647 T C 15: 76,795,314 (GRCm39) T449A possibly damaging Het
Zfp938 C T 10: 82,061,465 (GRCm39) G385D probably damaging Het
Zfp959 T G 17: 56,204,404 (GRCm39) V147G probably damaging Het
Znfx1 A T 2: 166,892,270 (GRCm39) C649S probably damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101,037,256 (GRCm39) missense probably damaging 0.96
IGL01311:Arap1 APN 7 101,037,343 (GRCm39) nonsense probably null
IGL01349:Arap1 APN 7 101,036,359 (GRCm39) missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101,049,812 (GRCm39) critical splice donor site probably null
IGL01869:Arap1 APN 7 101,049,490 (GRCm39) missense probably damaging 1.00
IGL02156:Arap1 APN 7 101,037,937 (GRCm39) unclassified probably benign
IGL02320:Arap1 APN 7 101,034,236 (GRCm39) missense probably benign
IGL02478:Arap1 APN 7 101,049,332 (GRCm39) splice site probably null
R0133:Arap1 UTSW 7 101,035,436 (GRCm39) missense probably damaging 0.98
R0233:Arap1 UTSW 7 101,049,448 (GRCm39) missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101,049,448 (GRCm39) missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101,039,429 (GRCm39) missense probably damaging 0.98
R0616:Arap1 UTSW 7 101,050,857 (GRCm39) missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101,049,619 (GRCm39) missense probably damaging 1.00
R0962:Arap1 UTSW 7 101,034,121 (GRCm39) missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101,053,476 (GRCm39) splice site probably benign
R1405:Arap1 UTSW 7 101,047,643 (GRCm39) splice site probably null
R1405:Arap1 UTSW 7 101,047,643 (GRCm39) splice site probably null
R1724:Arap1 UTSW 7 101,049,733 (GRCm39) missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101,037,829 (GRCm39) missense probably benign
R1960:Arap1 UTSW 7 101,022,222 (GRCm39) missense probably damaging 1.00
R2020:Arap1 UTSW 7 101,050,725 (GRCm39) missense probably benign 0.00
R2128:Arap1 UTSW 7 101,058,527 (GRCm39) missense probably damaging 1.00
R3737:Arap1 UTSW 7 101,049,484 (GRCm39) missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101,039,372 (GRCm39) nonsense probably null
R4034:Arap1 UTSW 7 101,049,484 (GRCm39) missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101,034,778 (GRCm39) missense probably benign
R4435:Arap1 UTSW 7 101,039,461 (GRCm39) missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101,053,574 (GRCm39) missense probably damaging 1.00
R4786:Arap1 UTSW 7 101,034,212 (GRCm39) missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101,047,998 (GRCm39) missense probably damaging 1.00
R4942:Arap1 UTSW 7 101,051,009 (GRCm39) missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101,037,851 (GRCm39) missense probably benign 0.00
R5342:Arap1 UTSW 7 101,054,167 (GRCm39) missense probably benign 0.00
R5367:Arap1 UTSW 7 101,058,337 (GRCm39) missense probably damaging 0.99
R5397:Arap1 UTSW 7 101,034,119 (GRCm39) missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101,043,945 (GRCm39) missense probably damaging 1.00
R6052:Arap1 UTSW 7 101,053,240 (GRCm39) missense probably damaging 1.00
R6574:Arap1 UTSW 7 101,053,208 (GRCm39) missense probably damaging 1.00
R6645:Arap1 UTSW 7 101,057,318 (GRCm39) missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101,058,564 (GRCm39) splice site probably null
R7191:Arap1 UTSW 7 101,034,199 (GRCm39) missense probably benign 0.31
R7323:Arap1 UTSW 7 101,049,418 (GRCm39) missense probably damaging 1.00
R7349:Arap1 UTSW 7 101,039,435 (GRCm39) missense possibly damaging 0.95
R7516:Arap1 UTSW 7 101,058,538 (GRCm39) missense probably benign 0.00
R7922:Arap1 UTSW 7 101,053,621 (GRCm39) nonsense probably null
R8034:Arap1 UTSW 7 101,043,980 (GRCm39) missense probably damaging 1.00
R8293:Arap1 UTSW 7 101,050,141 (GRCm39) missense probably benign
R8493:Arap1 UTSW 7 101,035,725 (GRCm39) nonsense probably null
R8810:Arap1 UTSW 7 101,053,585 (GRCm39) missense probably damaging 0.99
R8811:Arap1 UTSW 7 101,036,403 (GRCm39) missense probably damaging 1.00
R8928:Arap1 UTSW 7 101,057,324 (GRCm39) missense possibly damaging 0.52
R8930:Arap1 UTSW 7 101,057,324 (GRCm39) missense possibly damaging 0.52
R8931:Arap1 UTSW 7 101,057,324 (GRCm39) missense possibly damaging 0.52
R8941:Arap1 UTSW 7 101,057,324 (GRCm39) missense possibly damaging 0.52
R9014:Arap1 UTSW 7 101,053,540 (GRCm39) missense probably damaging 1.00
R9144:Arap1 UTSW 7 101,047,602 (GRCm39) missense probably damaging 1.00
R9164:Arap1 UTSW 7 101,041,090 (GRCm39) nonsense probably null
R9215:Arap1 UTSW 7 101,049,214 (GRCm39) missense probably benign 0.23
R9340:Arap1 UTSW 7 101,037,382 (GRCm39) missense probably damaging 1.00
R9519:Arap1 UTSW 7 101,043,946 (GRCm39) start gained probably benign
R9790:Arap1 UTSW 7 101,037,376 (GRCm39) missense probably benign 0.00
R9791:Arap1 UTSW 7 101,037,376 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGCATAAGCAGGTCTGGG -3'
(R):5'- AGATGTGTCGCTTCATCGG -3'

Sequencing Primer
(F):5'- CATAAGCAGGTCTGGGTATTTCAG -3'
(R):5'- CATGGGCGCGGTGAAGAC -3'
Posted On 2014-08-01