Incidental Mutation 'R1959:Muc5b'
ID218161
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Namemucin 5, subtype B, tracheobronchial
SynonymsMUC5, MUC9, 2300002I04Rik
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141839070-141873084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141862637 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 3107 (C3107R)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165147
AA Change: C3107R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: C3107R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
profligate UTSW 7 141857822 nonsense probably null
wasteful UTSW 7 141858161 missense unknown
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1463:Muc5b UTSW 7 141859080 missense unknown
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4400:Muc5b UTSW 7 141861387 missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4749:Muc5b UTSW 7 141861448 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5580:Muc5b UTSW 7 141861347 missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141842455 missense unknown
R7116:Muc5b UTSW 7 141863750 missense probably benign 0.10
R7134:Muc5b UTSW 7 141857654 missense unknown
R7146:Muc5b UTSW 7 141863967 missense possibly damaging 0.96
R7168:Muc5b UTSW 7 141864017 missense probably benign 0.01
R7182:Muc5b UTSW 7 141842645 missense unknown
R7189:Muc5b UTSW 7 141861061 nonsense probably null
R7207:Muc5b UTSW 7 141862865 missense probably benign 0.01
R7232:Muc5b UTSW 7 141866129 missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141842648 missense unknown
R7269:Muc5b UTSW 7 141857535 missense unknown
R7273:Muc5b UTSW 7 141851570 missense unknown
R7278:Muc5b UTSW 7 141857502 missense unknown
R7307:Muc5b UTSW 7 141842294 missense unknown
R7323:Muc5b UTSW 7 141858707 missense unknown
R7374:Muc5b UTSW 7 141863126 missense probably benign 0.10
R7376:Muc5b UTSW 7 141872550 missense possibly damaging 0.53
R7382:Muc5b UTSW 7 141858948 missense unknown
R7481:Muc5b UTSW 7 141861171 missense unknown
R7497:Muc5b UTSW 7 141861513 missense possibly damaging 0.92
R7554:Muc5b UTSW 7 141858776 missense unknown
R7571:Muc5b UTSW 7 141847249 missense unknown
R7598:Muc5b UTSW 7 141859262 missense unknown
R7609:Muc5b UTSW 7 141861729 missense possibly damaging 0.86
R7615:Muc5b UTSW 7 141864892 nonsense probably null
R7618:Muc5b UTSW 7 141867597 missense probably benign 0.01
R7651:Muc5b UTSW 7 141864023 missense possibly damaging 0.75
R7692:Muc5b UTSW 7 141853229 missense unknown
R7731:Muc5b UTSW 7 141857305 critical splice acceptor site probably null
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCAAGGCCCAGCATAGTC -3'
(R):5'- GTCGTTGAGACCGATCCTTC -3'

Sequencing Primer
(F):5'- GCATAGTCACACAGCCAGTCAG -3'
(R):5'- ATCCTTCAGGGGTGGTAGATCCC -3'
Posted On2014-08-01