Mutagenetix > Incidental Mutation

Incidental Mutation 'R1959:Pkd1l2'

218165

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l2

Ensembl Gene

ENSMUSG00000034416

Gene Name

polycystic kidney disease 1 like 2

Synonyms

MMRRC Submission

039973-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1959 (G1)

Quality Score

168

Status

Not validated

Chromosome

Chromosomal Location

116995679-117082449 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 117043231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000098375

SMART Domains

Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	1.8e-18	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	510	886	1.8e-13	PFAM
low complexity region	1050	1060	N/A	INTRINSIC
GPS	1278	1327	1.61e-11	SMART
transmembrane domain	1346	1365	N/A	INTRINSIC
LH2	1390	1509	6.05e-13	SMART
transmembrane domain	1552	1574	N/A	INTRINSIC
transmembrane domain	1589	1611	N/A	INTRINSIC
transmembrane domain	1815	1837	N/A	INTRINSIC
transmembrane domain	1852	1874	N/A	INTRINSIC
transmembrane domain	1940	1962	N/A	INTRINSIC
Pfam:PKD_channel	1980	2403	6.4e-107	PFAM
Pfam:Ion_trans	2187	2396	2.5e-12	PFAM
low complexity region	2441	2458	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109093

SMART Domains

Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	6.9e-19	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	519	883	7e-11	PFAM
low complexity region	1051	1061	N/A	INTRINSIC
GPS	1279	1328	1.61e-11	SMART
transmembrane domain	1347	1366	N/A	INTRINSIC
LH2	1391	1510	6.05e-13	SMART
transmembrane domain	1553	1575	N/A	INTRINSIC
transmembrane domain	1590	1612	N/A	INTRINSIC
transmembrane domain	1816	1838	N/A	INTRINSIC
transmembrane domain	1853	1875	N/A	INTRINSIC
transmembrane domain	1941	1963	N/A	INTRINSIC
Pfam:PKD_channel	1981	2403	5.9e-106	PFAM
Pfam:Ion_trans	2138	2409	3.4e-12	PFAM
low complexity region	2442	2459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153724

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Anapc1	C	A	2: 128,633,415	R1381S	probably benign	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Fsip2	A	G	2: 82,991,550	K5876E	probably benign	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Lama2	G	T	10: 27,422,618	P161T	probably damaging	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Sec16a	A	T	2: 26,430,132	H1431Q	probably benign	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Sox5	A	G	6: 143,874,105	S62P	possibly damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Pkd1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Pkd1l2	APN	8	117059520	nonsense	probably null
IGL01353:Pkd1l2	APN	8	117057443	missense	probably benign	0.24
IGL01362:Pkd1l2	APN	8	117021856	missense	probably damaging	1.00
IGL01486:Pkd1l2	APN	8	117059592	missense	probably benign
IGL01672:Pkd1l2	APN	8	117080732	missense	possibly damaging	0.94
IGL01696:Pkd1l2	APN	8	117056387	missense	probably benign	0.12
IGL01819:Pkd1l2	APN	8	116998174	missense	probably damaging	1.00
IGL01833:Pkd1l2	APN	8	117060525	missense	probably benign	0.00
IGL01981:Pkd1l2	APN	8	117016916	missense	probably benign	0.04
IGL02066:Pkd1l2	APN	8	117009564	splice site	probably benign
IGL02381:Pkd1l2	APN	8	117035800	splice site	probably benign
IGL02416:Pkd1l2	APN	8	117040835	missense	possibly damaging	0.82
IGL02736:Pkd1l2	APN	8	117040666	missense	probably benign	0.00
IGL02828:Pkd1l2	APN	8	117029559	missense	probably benign
IGL02861:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02862:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02883:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02884:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02894:Pkd1l2	APN	8	117013891	missense	probably damaging	0.97
IGL02900:Pkd1l2	APN	8	117024091	missense	probably benign	0.03
IGL02901:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02929:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02941:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02957:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02969:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03028:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03059:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03065:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03066:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03083:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03084:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03124:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03162:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03165:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03335:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03357:Pkd1l2	APN	8	116995809	missense	probably damaging	1.00
IGL02835:Pkd1l2	UTSW	8	117065745	missense	probably benign	0.07
PIT4453001:Pkd1l2	UTSW	8	117022022	missense	probably benign	0.00
R0127:Pkd1l2	UTSW	8	117050048	splice site	probably benign
R0309:Pkd1l2	UTSW	8	116997576	missense	probably damaging	0.99
R0365:Pkd1l2	UTSW	8	117021850	missense	probably benign	0.02
R0526:Pkd1l2	UTSW	8	117082260	missense	probably damaging	1.00
R0571:Pkd1l2	UTSW	8	117082218	missense	probably benign	0.01
R0716:Pkd1l2	UTSW	8	117051100	missense	probably damaging	1.00
R0787:Pkd1l2	UTSW	8	117076177	missense	possibly damaging	0.90
R0893:Pkd1l2	UTSW	8	117044492	missense	probably damaging	0.99
R1256:Pkd1l2	UTSW	8	117019543	critical splice acceptor site	probably null
R1391:Pkd1l2	UTSW	8	117054934	missense	possibly damaging	0.87
R1474:Pkd1l2	UTSW	8	117065497	splice site	probably benign
R1491:Pkd1l2	UTSW	8	117028408	missense	probably damaging	1.00
R1520:Pkd1l2	UTSW	8	117046159	missense	probably benign	0.00
R1521:Pkd1l2	UTSW	8	117065500	splice site	probably null
R1544:Pkd1l2	UTSW	8	117038235	frame shift	probably null
R1558:Pkd1l2	UTSW	8	117082252	missense	possibly damaging	0.94
R1673:Pkd1l2	UTSW	8	117040775	missense	probably benign	0.00
R1691:Pkd1l2	UTSW	8	117056419	missense	possibly damaging	0.60
R1754:Pkd1l2	UTSW	8	117030719	missense	possibly damaging	0.81
R1857:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R1939:Pkd1l2	UTSW	8	117046182	nonsense	probably null
R1955:Pkd1l2	UTSW	8	117043361	missense	probably benign
R1957:Pkd1l2	UTSW	8	117030682	missense	probably damaging	1.00
R2024:Pkd1l2	UTSW	8	117019533	missense	probably benign
R2046:Pkd1l2	UTSW	8	116999955	missense	probably damaging	1.00
R2102:Pkd1l2	UTSW	8	117081469	missense	probably damaging	0.98
R2116:Pkd1l2	UTSW	8	117030722	missense	possibly damaging	0.93
R2148:Pkd1l2	UTSW	8	117056325	missense	probably damaging	0.98
R2251:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2252:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2366:Pkd1l2	UTSW	8	117043317	missense	probably benign	0.01
R2566:Pkd1l2	UTSW	8	117019494	missense	probably damaging	1.00
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2985:Pkd1l2	UTSW	8	117065551	missense	probably benign	0.00
R3055:Pkd1l2	UTSW	8	117068315	critical splice acceptor site	probably null
R3436:Pkd1l2	UTSW	8	117040739	missense	probably benign	0.01
R4732:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4733:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4763:Pkd1l2	UTSW	8	117019429	missense	probably damaging	0.96
R4789:Pkd1l2	UTSW	8	117011575	missense	probably damaging	0.99
R4921:Pkd1l2	UTSW	8	117054885	missense	probably benign	0.03
R4921:Pkd1l2	UTSW	8	117072549	missense	probably damaging	0.97
R4999:Pkd1l2	UTSW	8	117047374	splice site	probably null
R5057:Pkd1l2	UTSW	8	117055008	missense	probably benign	0.21
R5209:Pkd1l2	UTSW	8	117056442	missense	probably benign	0.23
R5241:Pkd1l2	UTSW	8	117035118	missense	probably damaging	1.00
R5480:Pkd1l2	UTSW	8	117030649	missense	probably damaging	0.99
R5501:Pkd1l2	UTSW	8	117065830	missense	probably damaging	0.98
R5533:Pkd1l2	UTSW	8	117068116	missense	probably benign	0.03
R5582:Pkd1l2	UTSW	8	117040783	nonsense	probably null
R5610:Pkd1l2	UTSW	8	117042320	missense	probably benign	0.04
R5770:Pkd1l2	UTSW	8	117055018	missense	probably damaging	1.00
R5854:Pkd1l2	UTSW	8	117065746	missense	possibly damaging	0.48
R5867:Pkd1l2	UTSW	8	117055011	missense	probably damaging	0.96
R5881:Pkd1l2	UTSW	8	116997582	missense	probably damaging	0.99
R5906:Pkd1l2	UTSW	8	117029648	missense	probably damaging	1.00
R5909:Pkd1l2	UTSW	8	117024056	missense	probably benign	0.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6084:Pkd1l2	UTSW	8	117013987	missense	probably damaging	1.00
R6122:Pkd1l2	UTSW	8	117082368	missense	probably benign	0.02
R6216:Pkd1l2	UTSW	8	117081470	missense	probably damaging	1.00
R6406:Pkd1l2	UTSW	8	117035847	missense	probably damaging	0.99
R6417:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6420:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6601:Pkd1l2	UTSW	8	117040666	missense	probably benign	0.00
R6743:Pkd1l2	UTSW	8	117030631	missense	probably damaging	1.00
R7053:Pkd1l2	UTSW	8	117013942	missense	probably damaging	1.00
R7144:Pkd1l2	UTSW	8	117076131	nonsense	probably null
R7148:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7169:Pkd1l2	UTSW	8	117040835	missense	possibly damaging	0.82
R7217:Pkd1l2	UTSW	8	116995797	missense	probably benign	0.24
R7310:Pkd1l2	UTSW	8	117024034	missense	probably benign
R7382:Pkd1l2	UTSW	8	117054871	missense	possibly damaging	0.95
R7397:Pkd1l2	UTSW	8	117035902	missense	possibly damaging	0.94
R7408:Pkd1l2	UTSW	8	117028479	missense	possibly damaging	0.77
R7437:Pkd1l2	UTSW	8	117030682	missense	probably damaging	0.96
R7492:Pkd1l2	UTSW	8	117068110	missense	probably damaging	1.00
R7496:Pkd1l2	UTSW	8	117060594	missense	possibly damaging	0.89
R7519:Pkd1l2	UTSW	8	117065529	missense	probably benign
R7590:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7623:Pkd1l2	UTSW	8	117029645	missense	probably damaging	1.00
R7768:Pkd1l2	UTSW	8	117054860	critical splice donor site	probably null
R7897:Pkd1l2	UTSW	8	116998088	missense	possibly damaging	0.69
R7982:Pkd1l2	UTSW	8	117051187	missense	possibly damaging	0.70
R8024:Pkd1l2	UTSW	8	117076182	missense	possibly damaging	0.85
R8140:Pkd1l2	UTSW	8	117047497	missense	probably benign
R8145:Pkd1l2	UTSW	8	117055003	missense	probably benign
R8228:Pkd1l2	UTSW	8	117065775	missense	probably damaging	0.97
R8252:Pkd1l2	UTSW	8	117040733	missense	probably benign	0.29
R8500:Pkd1l2	UTSW	8	117047563	critical splice acceptor site	probably null
R8732:Pkd1l2	UTSW	8	117065572	missense	probably benign	0.28
R8809:Pkd1l2	UTSW	8	116999921	missense	probably damaging	1.00
R8896:Pkd1l2	UTSW	8	117013876	missense	possibly damaging	0.91
R8961:Pkd1l2	UTSW	8	116999978	missense	possibly damaging	0.52
R8985:Pkd1l2	UTSW	8	117038110	missense	probably benign	0.01
R9008:Pkd1l2	UTSW	8	117042298	missense	probably benign	0.32
R9091:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
R9138:Pkd1l2	UTSW	8	117055009	missense	probably benign	0.43
R9160:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R9249:Pkd1l2	UTSW	8	117019420	missense	probably damaging	0.99
R9270:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
R9735:Pkd1l2	UTSW	8	117046081	missense	possibly damaging	0.94
Z1176:Pkd1l2	UTSW	8	117054914	missense	probably damaging	1.00
Z1177:Pkd1l2	UTSW	8	117030691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGTGTGAATGGCCATATATGC -3'
(R):5'- CTGCATCCACCTCATAGAGC -3'

Sequencing Primer
(F):5'- GGCCATATATGCATGGTTTAAAGCTG -3'
(R):5'- TCATAGAGCGAGGGCCAGTC -3'

Posted On

2014-08-01