Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Exoc4'

21817

Institutional Source

Beutler Lab

Gene Symbol

Exoc4

Ensembl Gene

ENSMUSG00000029763

Gene Name

exocyst complex component 4

Synonyms

Sec8l1, Sec8

MMRRC Submission

038419-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0134 (G1)

Quality Score

218

Status

Validated (trace)

Chromosome

Chromosomal Location

33249085-33973979 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33971946 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 908 (D908G)

Ref Sequence

ENSEMBL: ENSMUSP00000051965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052266]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052266
AA Change: D908G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: D908G

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	28	144	2.4e-21	PFAM
low complexity region	338	346	N/A	INTRINSIC

Meta Mutation Damage Score

0.2216

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Exoc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Exoc4	APN	6	33918399	critical splice acceptor site	probably null
IGL00433:Exoc4	APN	6	33296788	missense	probably damaging	1.00
IGL00833:Exoc4	APN	6	33971924	missense	probably damaging	1.00
IGL01339:Exoc4	APN	6	33305400	splice site	probably benign
IGL01559:Exoc4	APN	6	33266076	missense	probably damaging	0.96
IGL01812:Exoc4	APN	6	33757959	splice site	probably benign
IGL01926:Exoc4	APN	6	33862142	missense	probably damaging	1.00
IGL02270:Exoc4	APN	6	33580026	missense	possibly damaging	0.61
IGL02316:Exoc4	APN	6	33910584	missense	probably damaging	0.98
IGL02332:Exoc4	APN	6	33249240	critical splice donor site	probably null
IGL02668:Exoc4	APN	6	33921532	missense	probably benign	0.00
slacker	UTSW	6	33758098	missense	probably damaging	1.00
R0049:Exoc4	UTSW	6	33296922	splice site	probably null
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0538:Exoc4	UTSW	6	33972063	missense	probably benign	0.09
R1033:Exoc4	UTSW	6	33265987	missense	probably damaging	1.00
R1067:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R1109:Exoc4	UTSW	6	33442016	missense	probably damaging	1.00
R1768:Exoc4	UTSW	6	33758050	missense	probably damaging	1.00
R2013:Exoc4	UTSW	6	33266091	missense	probably damaging	0.96
R2078:Exoc4	UTSW	6	33910587	missense	probably benign	0.06
R2114:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2115:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2117:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2133:Exoc4	UTSW	6	33758158	missense	probably benign	0.00
R2133:Exoc4	UTSW	6	33910538	missense	probably benign
R2308:Exoc4	UTSW	6	33918568	missense	probably damaging	1.00
R3412:Exoc4	UTSW	6	33265975	missense	probably damaging	1.00
R3794:Exoc4	UTSW	6	33475997	missense	probably benign
R3885:Exoc4	UTSW	6	33266131	critical splice donor site	probably null
R4378:Exoc4	UTSW	6	33815687	missense	probably damaging	1.00
R4534:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4535:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4536:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4611:Exoc4	UTSW	6	33438405	missense	possibly damaging	0.77
R4617:Exoc4	UTSW	6	33862204	missense	probably benign	0.00
R4771:Exoc4	UTSW	6	33441949	critical splice acceptor site	probably null
R4851:Exoc4	UTSW	6	33918408	missense	probably damaging	0.96
R4921:Exoc4	UTSW	6	33910517	missense	probably benign
R5358:Exoc4	UTSW	6	33265999	missense	probably damaging	1.00
R5767:Exoc4	UTSW	6	33918432	missense	probably benign
R6014:Exoc4	UTSW	6	33475997	missense	probably benign
R6132:Exoc4	UTSW	6	33758098	missense	probably damaging	1.00
R6164:Exoc4	UTSW	6	33332283	missense	probably damaging	0.99
R6583:Exoc4	UTSW	6	33815753	missense	probably damaging	1.00
R6915:Exoc4	UTSW	6	33921453	missense	possibly damaging	0.81
R6973:Exoc4	UTSW	6	33580030	missense	probably damaging	1.00
R7112:Exoc4	UTSW	6	33921488	missense	probably damaging	1.00
R7129:Exoc4	UTSW	6	33971999	missense	probably damaging	1.00
R7133:Exoc4	UTSW	6	33438473	missense	probably benign	0.07
R7547:Exoc4	UTSW	6	33839121	missense	possibly damaging	0.95
R7885:Exoc4	UTSW	6	33758066	missense	probably benign	0.00
R8024:Exoc4	UTSW	6	33347931	missense	probably damaging	1.00
R8053:Exoc4	UTSW	6	33332256	missense	probably benign	0.45
R8118:Exoc4	UTSW	6	33971918	missense	probably damaging	1.00
R8154:Exoc4	UTSW	6	33910538	missense	probably benign
R8485:Exoc4	UTSW	6	33921501	missense	probably damaging	1.00
X0066:Exoc4	UTSW	6	33815690	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCAGAAGAAAGCCATGTTTCCCAG -3'
(R):5'- TCAGTGTAGATGGAGCACAGCCAG -3'

Sequencing Primer
(F):5'- GTTTCCCAGAGTCTCCAATAAGG -3'
(R):5'- CATGCTGAGCAGCTAGAGTC -3'

Posted On

2013-04-12