Mutagenetix > Incidental Mutation

Incidental Mutation 'R1959:Lama2'

218175

Institutional Source

Beutler Lab

Gene Symbol

Lama2

Ensembl Gene

ENSMUSG00000019899

Gene Name

laminin, alpha 2

Synonyms

merosin, mer

MMRRC Submission

039973-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R1959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26980036-27619758 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 27422618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 161 (P161T)

Ref Sequence

ENSEMBL: ENSMUSP00000140716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000092639
AA Change: P161T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: P161T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	29	281	5.35e-129	SMART
EGF_Lam	283	337	2.11e-4	SMART
EGF_Lam	340	407	1.59e-8	SMART
EGF_Lam	410	462	5.44e-7	SMART
EGF_Lam	465	511	9.05e-4	SMART
LamB	574	706	2.26e-44	SMART
Pfam:Laminin_EGF	715	745	2.8e-4	PFAM
EGF_Lam	753	800	4.03e-10	SMART
EGF_Lam	803	858	3.01e-9	SMART
EGF_Lam	861	911	1.35e-11	SMART
EGF_Lam	914	960	7.23e-12	SMART
EGF_Lam	963	1007	5.87e-12	SMART
EGF_Lam	1010	1053	1.28e-12	SMART
EGF_Lam	1056	1099	2.37e-7	SMART
EGF_Lam	1102	1159	3.22e-9	SMART
LamB	1225	1360	1.95e-57	SMART
EGF_like	1364	1413	8.13e-1	SMART
EGF_Lam	1416	1462	5.48e-12	SMART
EGF_Lam	1465	1520	1.27e-7	SMART
EGF_Lam	1523	1567	2.4e-8	SMART
Pfam:Laminin_I	1584	1849	2e-92	PFAM
Blast:MA	1881	2113	1e-112	BLAST
LamG	2162	2307	1.28e-25	SMART
LamG	2356	2500	2.2e-33	SMART
LamG	2542	2688	3.31e-28	SMART
low complexity region	2725	2741	N/A	INTRINSIC
LamG	2781	2914	2.25e-39	SMART
LamG	2956	3092	1.53e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185839

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188963

Predicted Effect

probably damaging
Transcript: ENSMUST00000189575
AA Change: P161T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: P161T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	29	281	2.5e-131	SMART
EGF_Lam	283	337	1e-6	SMART
EGF_Lam	340	407	7.7e-11	SMART
EGF_Lam	410	462	2.6e-9	SMART
EGF_Lam	465	511	4.5e-6	SMART
LamB	574	706	1.4e-46	SMART
Pfam:Laminin_EGF	715	745	1.7e-2	PFAM
EGF_Lam	753	800	1.9e-12	SMART
EGF_Lam	803	858	1.4e-11	SMART
EGF_Lam	861	911	6.7e-14	SMART
EGF_Lam	914	960	3.6e-14	SMART
EGF_Lam	963	1007	2.9e-14	SMART
EGF_Lam	1010	1053	6.1e-15	SMART
EGF_Lam	1056	1099	1.1e-9	SMART
EGF_Lam	1102	1159	1.5e-11	SMART
LamB	1225	1349	1.4e-45	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Anapc1	C	A	2: 128,633,415	R1381S	probably benign	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Fsip2	A	G	2: 82,991,550	K5876E	probably benign	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pkd1l2	A	T	8: 117,043,231		probably null	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Sec16a	A	T	2: 26,430,132	H1431Q	probably benign	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Sox5	A	G	6: 143,874,105	S62P	possibly damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Lama2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Lama2	APN	10	27188265	missense	probably benign	0.01
IGL00467:Lama2	APN	10	27467197	splice site	probably benign
IGL00470:Lama2	APN	10	27243742	missense	probably benign	0.22
IGL00517:Lama2	APN	10	27197330	missense	probably benign	0.01
IGL00541:Lama2	APN	10	27188306	missense	probably benign	0.14
IGL00931:Lama2	APN	10	27006776	missense	possibly damaging	0.92
IGL00951:Lama2	APN	10	27030285	missense	probably benign	0.03
IGL00988:Lama2	APN	10	27369015	nonsense	probably null
IGL01098:Lama2	APN	10	27031112	missense	possibly damaging	0.66
IGL01152:Lama2	APN	10	27208429	missense	probably benign	0.00
IGL01293:Lama2	APN	10	27231636	missense	probably benign	0.38
IGL01338:Lama2	APN	10	27188272	missense	probably benign	0.13
IGL01609:Lama2	APN	10	27344421	missense	probably benign	0.03
IGL01643:Lama2	APN	10	27070372	splice site	probably benign
IGL01675:Lama2	APN	10	27188054	missense	possibly damaging	0.77
IGL01681:Lama2	APN	10	27265045	missense	probably benign	0.33
IGL01694:Lama2	APN	10	27006742	missense	possibly damaging	0.75
IGL01705:Lama2	APN	10	27189274	splice site	probably benign
IGL01885:Lama2	APN	10	27105139	nonsense	probably null
IGL01935:Lama2	APN	10	27422604	missense	probably damaging	0.98
IGL01994:Lama2	APN	10	27467203	critical splice donor site	probably null
IGL02041:Lama2	APN	10	26984326	missense	probably damaging	1.00
IGL02067:Lama2	APN	10	27176796	missense	probably benign	0.02
IGL02097:Lama2	APN	10	27138960	missense	probably benign	0.09
IGL02179:Lama2	APN	10	27070364	missense	probably benign	0.01
IGL02268:Lama2	APN	10	27001116	splice site	probably benign
IGL02302:Lama2	APN	10	27212043	missense	probably benign	0.06
IGL02363:Lama2	APN	10	27366066	missense	probably damaging	1.00
IGL02378:Lama2	APN	10	27043656	missense	probably damaging	0.99
IGL02642:Lama2	APN	10	27467273	missense	probably damaging	1.00
IGL02676:Lama2	APN	10	27118493	missense	probably benign	0.00
IGL02695:Lama2	APN	10	27000775	missense	probably benign
IGL02735:Lama2	APN	10	27104128	missense	probably damaging	1.00
IGL02794:Lama2	APN	10	27041231	missense	possibly damaging	0.73
IGL02823:Lama2	APN	10	27001145	missense	probably damaging	1.00
IGL02869:Lama2	APN	10	27015538	missense	probably damaging	0.99
IGL02942:Lama2	APN	10	27041220	missense	probably damaging	1.00
IGL03201:Lama2	APN	10	27344570	nonsense	probably null
IGL03268:Lama2	APN	10	27422653	missense	probably damaging	1.00
IGL03288:Lama2	APN	10	27369051	missense	probably damaging	1.00
IGL03380:Lama2	APN	10	27050265	missense	probably damaging	1.00
IGL03407:Lama2	APN	10	27347021	missense	probably damaging	1.00
cowboy	UTSW	10	27043643	frame shift	probably null
petri	UTSW	10	26993398	splice site	probably null
PIT4362001:Lama2	UTSW	10	27369136	missense	probably damaging	1.00
PIT4382001:Lama2	UTSW	10	27204905	missense	probably damaging	1.00
PIT4431001:Lama2	UTSW	10	27101430	missense	probably damaging	1.00
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0114:Lama2	UTSW	10	26993068	nonsense	probably null
R0142:Lama2	UTSW	10	27187845	missense	probably benign
R0313:Lama2	UTSW	10	26993398	splice site	probably null
R0376:Lama2	UTSW	10	27015546	missense	possibly damaging	0.68
R0412:Lama2	UTSW	10	27190625	missense	possibly damaging	0.58
R0472:Lama2	UTSW	10	26990867	missense	probably damaging	1.00
R0607:Lama2	UTSW	10	27189131	missense	probably benign	0.34
R0648:Lama2	UTSW	10	26989376	missense	probably benign	0.00
R0667:Lama2	UTSW	10	27344410	splice site	probably null
R0760:Lama2	UTSW	10	27044433	critical splice donor site	probably null
R1240:Lama2	UTSW	10	27041124	missense	probably damaging	1.00
R1385:Lama2	UTSW	10	27224043	missense	probably benign	0.11
R1433:Lama2	UTSW	10	27187754	missense	probably damaging	1.00
R1434:Lama2	UTSW	10	27208370	missense	probably damaging	1.00
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1645:Lama2	UTSW	10	27368985	missense	probably damaging	1.00
R1702:Lama2	UTSW	10	27190529	missense	probably benign
R1703:Lama2	UTSW	10	27266671	missense	probably damaging	1.00
R1769:Lama2	UTSW	10	27208406	missense	probably damaging	1.00
R1769:Lama2	UTSW	10	27208407	missense	probably benign
R1846:Lama2	UTSW	10	27212096	missense	probably damaging	1.00
R1859:Lama2	UTSW	10	27031082	missense	possibly damaging	0.51
R1871:Lama2	UTSW	10	26984494	missense	probably damaging	1.00
R1903:Lama2	UTSW	10	27188399	missense	probably damaging	1.00
R1906:Lama2	UTSW	10	27056527	critical splice donor site	probably null
R1958:Lama2	UTSW	10	26981598	missense	probably damaging	0.97
R1977:Lama2	UTSW	10	26990800	splice site	probably null
R2063:Lama2	UTSW	10	27164926	missense	probably damaging	1.00
R2079:Lama2	UTSW	10	27369053	missense	probably damaging	0.99
R2085:Lama2	UTSW	10	27204841	nonsense	probably null
R2125:Lama2	UTSW	10	27044453	nonsense	probably null
R2140:Lama2	UTSW	10	27054694	splice site	probably null
R2219:Lama2	UTSW	10	27043569	missense	probably damaging	0.99
R2259:Lama2	UTSW	10	27031127	missense	probably benign	0.00
R2265:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2266:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R2267:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2268:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2269:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2862:Lama2	UTSW	10	27422612	nonsense	probably null
R2912:Lama2	UTSW	10	27000803	missense	probably benign
R2999:Lama2	UTSW	10	26989421	missense	probably benign	0.18
R3034:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3081:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3107:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3109:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3436:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3437:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3706:Lama2	UTSW	10	27138996	missense	probably damaging	1.00
R3780:Lama2	UTSW	10	27459339	missense	probably damaging	1.00
R3807:Lama2	UTSW	10	27190665	frame shift	probably null
R3919:Lama2	UTSW	10	27118505	missense	probably damaging	1.00
R4014:Lama2	UTSW	10	26984376	missense	probably damaging	1.00
R4131:Lama2	UTSW	10	27041174	missense	probably benign	0.00
R4190:Lama2	UTSW	10	27266664	missense	probably damaging	0.96
R4273:Lama2	UTSW	10	27347054	missense	probably damaging	1.00
R4358:Lama2	UTSW	10	26984493	missense	probably damaging	1.00
R4407:Lama2	UTSW	10	27212128	small deletion	probably benign
R4415:Lama2	UTSW	10	26989344	nonsense	probably null
R4426:Lama2	UTSW	10	27422558	missense	probably damaging	1.00
R4590:Lama2	UTSW	10	26989414	missense	probably benign	0.00
R4615:Lama2	UTSW	10	26981524	missense	probably damaging	0.99
R4736:Lama2	UTSW	10	27204929	missense	probably damaging	1.00
R4754:Lama2	UTSW	10	27118531	missense	possibly damaging	0.58
R4791:Lama2	UTSW	10	27467271	missense	probably damaging	1.00
R4834:Lama2	UTSW	10	27006749	missense	probably benign	0.30
R4856:Lama2	UTSW	10	27043643	frame shift	probably null
R4858:Lama2	UTSW	10	27043643	frame shift	probably null
R4859:Lama2	UTSW	10	27043643	frame shift	probably null
R4897:Lama2	UTSW	10	27043643	frame shift	probably null
R4898:Lama2	UTSW	10	27043643	frame shift	probably null
R4899:Lama2	UTSW	10	27043643	frame shift	probably null
R4907:Lama2	UTSW	10	27164946	missense	probably benign	0.11
R4911:Lama2	UTSW	10	27138927	missense	probably damaging	1.00
R4924:Lama2	UTSW	10	27369141	missense	probably damaging	0.98
R5023:Lama2	UTSW	10	27190504	missense	probably damaging	0.97
R5057:Lama2	UTSW	10	27164986	missense	probably damaging	1.00
R5070:Lama2	UTSW	10	27350251	critical splice donor site	probably null
R5116:Lama2	UTSW	10	27118560	missense	probably benign	0.08
R5177:Lama2	UTSW	10	27190703	missense	possibly damaging	0.94
R5198:Lama2	UTSW	10	27347003	missense	probably damaging	0.96
R5289:Lama2	UTSW	10	27212073	nonsense	probably null
R5327:Lama2	UTSW	10	27138946	missense	probably benign
R5424:Lama2	UTSW	10	26984396	missense	probably damaging	1.00
R5469:Lama2	UTSW	10	27041189	missense	possibly damaging	0.92
R5620:Lama2	UTSW	10	26990880	missense	probably damaging	0.99
R5667:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5671:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5815:Lama2	UTSW	10	26986851	missense	probably damaging	1.00
R5917:Lama2	UTSW	10	27190697	missense	probably damaging	1.00
R5935:Lama2	UTSW	10	27015498	missense	probably benign
R5976:Lama2	UTSW	10	27190676	missense	probably benign	0.00
R5979:Lama2	UTSW	10	27235732	missense	probably damaging	0.99
R6004:Lama2	UTSW	10	27235785	missense	probably benign	0.01
R6180:Lama2	UTSW	10	26981499	missense	probably benign	0.03
R6198:Lama2	UTSW	10	27188022	missense	probably damaging	1.00
R6257:Lama2	UTSW	10	26986899	missense	possibly damaging	0.85
R6271:Lama2	UTSW	10	27023329	missense	possibly damaging	0.67
R6322:Lama2	UTSW	10	27190547	missense	probably damaging	0.96
R6354:Lama2	UTSW	10	27212068	missense	probably damaging	1.00
R6431:Lama2	UTSW	10	27053031	missense	possibly damaging	0.50
R6499:Lama2	UTSW	10	27031158	missense	probably damaging	1.00
R6535:Lama2	UTSW	10	27104131	missense	probably damaging	1.00
R6545:Lama2	UTSW	10	27176797	missense	probably benign
R6636:Lama2	UTSW	10	27124568	missense	probably benign	0.13
R6891:Lama2	UTSW	10	27328072	nonsense	probably null
R6891:Lama2	UTSW	10	27328082	nonsense	probably null
R6902:Lama2	UTSW	10	26981629	missense	probably damaging	1.00
R6908:Lama2	UTSW	10	27031196	splice site	probably null
R7168:Lama2	UTSW	10	27366152	critical splice acceptor site	probably null
R7233:Lama2	UTSW	10	27231663	missense	probably damaging	1.00
R7272:Lama2	UTSW	10	27124556	missense	probably damaging	1.00
R7274:Lama2	UTSW	10	27119980	missense	probably damaging	0.99
R7419:Lama2	UTSW	10	27266634	missense	probably benign
R7423:Lama2	UTSW	10	27212226	missense	probably benign	0.00
R7554:Lama2	UTSW	10	27155496	missense	probably damaging	1.00
R7569:Lama2	UTSW	10	27265050	missense	probably damaging	1.00
R7574:Lama2	UTSW	10	27006730	missense	probably benign	0.03
R7584:Lama2	UTSW	10	27104261	missense	possibly damaging	0.78
R7586:Lama2	UTSW	10	27101393	missense	probably benign	0.00
R7603:Lama2	UTSW	10	27266680	missense	possibly damaging	0.55
R7691:Lama2	UTSW	10	27208393	missense	possibly damaging	0.67
R7750:Lama2	UTSW	10	26990924	missense	probably damaging	0.97
R7841:Lama2	UTSW	10	27155533	missense	probably benign	0.00
R7864:Lama2	UTSW	10	27056615	missense	probably benign	0.08
R7960:Lama2	UTSW	10	26993098	missense	probably benign	0.04
R7964:Lama2	UTSW	10	27223981	critical splice donor site	probably null
R7980:Lama2	UTSW	10	27363613	missense	probably damaging	0.98
R8013:Lama2	UTSW	10	27344498	missense	probably benign	0.00
R8028:Lama2	UTSW	10	27328149	missense	probably benign	0.13
R8097:Lama2	UTSW	10	27190664	nonsense	probably null
R8100:Lama2	UTSW	10	27041117	missense	probably benign	0.03
R8110:Lama2	UTSW	10	26990870	missense	probably damaging	1.00
R8122:Lama2	UTSW	10	27054596	missense	possibly damaging	0.87
R8264:Lama2	UTSW	10	27467222	missense	probably benign	0.07
R8315:Lama2	UTSW	10	27422659	missense	probably damaging	1.00
R8318:Lama2	UTSW	10	26984338	missense	probably damaging	1.00
R8419:Lama2	UTSW	10	27422563	missense	probably benign	0.26
R8475:Lama2	UTSW	10	27101373	missense	possibly damaging	0.69
R8735:Lama2	UTSW	10	27190534	missense	probably damaging	1.00
R8754:Lama2	UTSW	10	27001151	missense	possibly damaging	0.83
R8817:Lama2	UTSW	10	27187873	missense	probably damaging	1.00
R8851:Lama2	UTSW	10	27366123	missense	possibly damaging	0.94
R8859:Lama2	UTSW	10	27459388	missense	possibly damaging	0.58
R8886:Lama2	UTSW	10	27369161	splice site	probably benign
R8937:Lama2	UTSW	10	26986820	missense	probably damaging	1.00
R8993:Lama2	UTSW	10	27422714	missense	possibly damaging	0.91
R9025:Lama2	UTSW	10	26984371	missense	probably benign	0.00
R9027:Lama2	UTSW	10	27204885	missense	probably damaging	1.00
R9047:Lama2	UTSW	10	27006701	missense	possibly damaging	0.50
R9075:Lama2	UTSW	10	26981592	missense	probably damaging	1.00
R9135:Lama2	UTSW	10	27422519	missense	probably damaging	1.00
R9165:Lama2	UTSW	10	27053026	critical splice donor site	probably null
R9192:Lama2	UTSW	10	27328185	missense	possibly damaging	0.95
R9254:Lama2	UTSW	10	27422689	missense	probably damaging	0.96
R9326:Lama2	UTSW	10	27030197	missense	probably benign	0.04
R9356:Lama2	UTSW	10	27212190	missense	probably damaging	0.99
R9358:Lama2	UTSW	10	27188382	missense	possibly damaging	0.95
R9358:Lama2	UTSW	10	27616765	missense	unknown
R9376:Lama2	UTSW	10	27118624	missense	probably benign	0.11
R9381:Lama2	UTSW	10	27188027	nonsense	probably null
R9397:Lama2	UTSW	10	27105121	missense	probably benign	0.01
R9460:Lama2	UTSW	10	27422479	missense	probably damaging	1.00
R9478:Lama2	UTSW	10	27015482	missense	probably damaging	0.98
R9503:Lama2	UTSW	10	26989444	missense	possibly damaging	0.57
R9514:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9515:Lama2	UTSW	10	27001174	missense	probably benign	0.23
R9516:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9533:Lama2	UTSW	10	26986875	missense	probably damaging	1.00
R9619:Lama2	UTSW	10	27188286	missense	probably damaging	1.00
R9721:Lama2	UTSW	10	27467342	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GCACTGACGTTAGTTACTGACAC -3'
(R):5'- AGCCGTCTTTCTATTTGGAATGAC -3'

Sequencing Primer
(F):5'- GCTATTTTACAGTACTCAATGCAGC -3'
(R):5'- CTATTTGGAATGACTGAGAGAGTGC -3'

Posted On

2014-08-01