Incidental Mutation 'R1959:Tanc2'
ID218193
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105910295 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1112 (H1112Q)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect unknown
Transcript: ENSMUST00000089485
AA Change: H156Q
SMART Domains Protein: ENSMUSP00000086912
Gene: ENSMUSG00000053580
AA Change: H156Q

DomainStartEndE-ValueType
ANK 35 63 1.16e3 SMART
ANK 78 107 3.31e-1 SMART
ANK 111 140 7.71e-2 SMART
ANK 144 173 6.12e-5 SMART
ANK 177 206 8.99e-3 SMART
ANK 210 239 5.71e-5 SMART
ANK 243 272 2.11e2 SMART
Blast:TPR 289 322 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000100330
AA Change: H1112Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: H1112Q

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146162
AA Change: H244Q
SMART Domains Protein: ENSMUSP00000123674
Gene: ENSMUSG00000053580
AA Change: H244Q

DomainStartEndE-ValueType
ANK 15 46 2.97e2 SMART
ANK 50 79 5.75e-1 SMART
ANK 83 112 8.62e1 SMART
ANK 123 151 1.16e3 SMART
ANK 166 195 3.31e-1 SMART
ANK 199 228 7.71e-2 SMART
ANK 232 261 6.12e-5 SMART
ANK 265 294 8.99e-3 SMART
ANK 298 327 5.71e-5 SMART
ANK 331 360 3.44e1 SMART
TPR 387 420 3.89e1 SMART
TPR 434 467 3.61e-2 SMART
TPR 468 501 2.82e-4 SMART
low complexity region 512 549 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147975
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGTAGGAGAGTGCATACATGTG -3'
(R):5'- GCAGGAGCATCTGGTTTTGC -3'

Sequencing Primer
(F):5'- GAGTGCATACATGTGTCATCTCAGC -3'
(R):5'- TTTGAACTCAGGACCTCTGGAAG -3'
Posted On2014-08-01