Incidental Mutation 'R1959:Dlgap5'
ID 218206
Institutional Source Beutler Lab
Gene Symbol Dlgap5
Ensembl Gene ENSMUSG00000037544
Gene Name DLG associated protein 5
Synonyms Dlg7, C86398, Hurp
MMRRC Submission 039973-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R1959 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 47625236-47655864 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47653843 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 62 (I62T)
Ref Sequence ENSEMBL: ENSMUSP00000154283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000178661] [ENSMUST00000180299]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043296
AA Change: I62T

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544
AA Change: I62T

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111778
SMART Domains Protein: ENSMUSP00000107408
Gene: ENSMUSG00000037544

DomainStartEndE-ValueType
Pfam:GKAP 78 303 3.9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178661
AA Change: I62T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179392
Predicted Effect probably benign
Transcript: ENSMUST00000180299
AA Change: I62T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226636
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display female infertility resulting from a defect in decidualization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Aco1 T C 4: 40,167,193 (GRCm39) probably null Het
Adap1 A G 5: 139,259,096 (GRCm39) Y364H probably benign Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgb A T 10: 10,270,993 (GRCm39) D883E probably benign Het
Anapc1 C A 2: 128,475,335 (GRCm39) R1381S probably benign Het
Aoah A G 13: 20,978,564 (GRCm39) M1V probably null Het
Arap1 C A 7: 101,022,222 (GRCm39) A8E probably damaging Het
Arhgap10 A G 8: 78,136,255 (GRCm39) F319S possibly damaging Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cabin1 A T 10: 75,570,924 (GRCm39) V784E possibly damaging Het
Card9 T A 2: 26,244,885 (GRCm39) probably null Het
Cdk18 A G 1: 132,045,559 (GRCm39) I238T possibly damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Commd3 A T 2: 18,678,774 (GRCm39) I70F probably benign Het
Cspg5 G A 9: 110,080,094 (GRCm39) V340M probably damaging Het
Cyb5r4 G A 9: 86,937,902 (GRCm39) S307N possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Ddx11 A G 17: 66,437,723 (GRCm39) M150V probably benign Het
Dennd4b A G 3: 90,176,080 (GRCm39) Y190C probably damaging Het
Det1 A G 7: 78,493,191 (GRCm39) V271A probably benign Het
Dgkd C A 1: 87,857,549 (GRCm39) P754T possibly damaging Het
Dhx36 T C 3: 62,386,806 (GRCm39) S649G probably benign Het
Dmgdh A G 13: 93,857,067 (GRCm39) M724V probably benign Het
Dnah7a A G 1: 53,724,142 (GRCm39) S108P probably benign Het
Dock4 A T 12: 40,760,797 (GRCm39) K495M probably damaging Het
Dse A G 10: 34,036,202 (GRCm39) Y225H probably damaging Het
Emx1 G A 6: 85,180,916 (GRCm39) R211K probably damaging Het
Ergic2 A G 6: 148,100,852 (GRCm39) probably null Het
Fbxo27 G A 7: 28,397,797 (GRCm39) C277Y possibly damaging Het
Fcrl1 T C 3: 87,283,827 (GRCm39) I9T possibly damaging Het
Fjx1 T C 2: 102,281,152 (GRCm39) E261G probably benign Het
Flacc1 A T 1: 58,698,437 (GRCm39) V327D possibly damaging Het
Flnb C T 14: 7,884,735 (GRCm38) Q445* probably null Het
Flrt2 G A 12: 95,747,074 (GRCm39) V471I probably benign Het
Frmd4a G A 2: 4,539,997 (GRCm39) V210M probably damaging Het
Fsip2 A G 2: 82,821,894 (GRCm39) K5876E probably benign Het
Galnt10 T C 11: 57,656,443 (GRCm39) L209P probably damaging Het
Gata5 A T 2: 179,968,729 (GRCm39) S382T possibly damaging Het
Glt6d1 C A 2: 25,684,425 (GRCm39) V194L probably damaging Het
Gm10803 T G 2: 93,394,288 (GRCm39) V20G unknown Het
Gm44511 T G 6: 128,797,234 (GRCm39) T52P probably damaging Het
Gpat4 A T 8: 23,672,952 (GRCm39) L88Q possibly damaging Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Hivep2 A T 10: 14,008,453 (GRCm39) I1684F probably benign Het
Hmcn1 T C 1: 150,525,427 (GRCm39) T3366A probably benign Het
Hnmt A G 2: 23,893,894 (GRCm39) V200A possibly damaging Het
Hps6 A T 19: 45,992,774 (GRCm39) H237L probably benign Het
Hspg2 C T 4: 137,292,206 (GRCm39) P4033S probably damaging Het
Ift70b C T 2: 75,767,443 (GRCm39) E437K probably benign Het
Irf9 T A 14: 55,845,174 (GRCm39) S297T possibly damaging Het
Kdm3b T C 18: 34,945,448 (GRCm39) V753A possibly damaging Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Krtap4-16 A G 11: 99,742,373 (GRCm39) V9A unknown Het
Lama2 G T 10: 27,298,614 (GRCm39) P161T probably damaging Het
Ltbp4 G A 7: 27,028,443 (GRCm39) P273L unknown Het
Lvrn T A 18: 47,027,784 (GRCm39) S866R probably damaging Het
Med13 A G 11: 86,189,805 (GRCm39) Y1035H probably damaging Het
Mertk T A 2: 128,601,010 (GRCm39) N331K probably damaging Het
Mios T A 6: 8,215,437 (GRCm39) F211Y probably benign Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Mphosph9 A T 5: 124,453,764 (GRCm39) S183T possibly damaging Het
Mrto4 A T 4: 139,076,949 (GRCm39) I56N probably damaging Het
Muc5b T C 7: 141,416,374 (GRCm39) C3107R possibly damaging Het
Ncoa2 A G 1: 13,230,476 (GRCm39) Y1023H probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Nr2f1 T C 13: 78,337,935 (GRCm39) T237A probably damaging Het
Nup205 C A 6: 35,210,301 (GRCm39) Q1621K probably benign Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Nxpe2 T A 9: 48,231,026 (GRCm39) S448C probably benign Het
Ogdh T A 11: 6,296,638 (GRCm39) C498S possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or14a256 A T 7: 86,265,639 (GRCm39) F71L probably benign Het
Or2ag15 T C 7: 106,340,601 (GRCm39) E180G probably damaging Het
Or2d2 A T 7: 106,727,717 (GRCm39) D294E possibly damaging Het
Or5ak24 T C 2: 85,260,963 (GRCm39) D70G probably damaging Het
Or5d46 T C 2: 88,170,545 (GRCm39) L212P probably damaging Het
Or6p1 A T 1: 174,258,471 (GRCm39) K159M probably damaging Het
Or8s8 T C 15: 98,354,634 (GRCm39) S148P probably damaging Het
Pcdhb9 T A 18: 37,536,369 (GRCm39) Y788N probably damaging Het
Pcsk5 T C 19: 17,410,782 (GRCm39) D1870G unknown Het
Pde6g A G 11: 120,338,962 (GRCm39) L76P probably damaging Het
Peak1 A T 9: 56,114,073 (GRCm39) Y593N probably damaging Het
Pfas C T 11: 68,885,110 (GRCm39) G16R probably damaging Het
Pkd1l2 A T 8: 117,769,970 (GRCm39) probably null Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Ptpru T A 4: 131,530,788 (GRCm39) I489F probably damaging Het
Rere T G 4: 150,553,247 (GRCm39) H146Q probably benign Het
Rundc1 A T 11: 101,322,322 (GRCm39) Q272L probably damaging Het
Scml4 T C 10: 42,832,017 (GRCm39) L305P probably damaging Het
Sec16a A T 2: 26,320,144 (GRCm39) H1431Q probably benign Het
Serpina1a G A 12: 103,820,059 (GRCm39) Q373* probably null Het
Shank1 A T 7: 43,974,801 (GRCm39) N377I unknown Het
Shc2 T C 10: 79,462,625 (GRCm39) probably null Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc7a2 A T 8: 41,368,002 (GRCm39) I589F probably damaging Het
Smim8 C T 4: 34,771,316 (GRCm39) R26Q probably damaging Het
Smox C A 2: 131,362,384 (GRCm39) A221D probably damaging Het
Sox5 A G 6: 143,819,831 (GRCm39) S62P possibly damaging Het
Spg21 A C 9: 65,391,774 (GRCm39) K240N probably damaging Het
Sv2c C T 13: 96,113,153 (GRCm39) V599M probably damaging Het
Tanc2 T A 11: 105,801,121 (GRCm39) H1112Q probably damaging Het
Tbata T C 10: 61,011,623 (GRCm39) I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 (GRCm39) Y842S probably benign Het
Tctn1 A T 5: 122,379,903 (GRCm39) probably null Het
Tenm1 T C X: 41,916,078 (GRCm39) D402G probably benign Het
Tfcp2l1 T C 1: 118,597,119 (GRCm39) V400A probably benign Het
Tm9sf2 T A 14: 122,363,576 (GRCm39) L99I probably benign Het
Top2a T C 11: 98,886,803 (GRCm39) probably null Het
Traf7 C A 17: 24,732,255 (GRCm39) G191C probably damaging Het
Trpm1 T A 7: 63,879,978 (GRCm39) L661Q probably damaging Het
Ttn T C 2: 76,580,967 (GRCm39) I23309V probably benign Het
Usp50 T C 2: 126,619,881 (GRCm39) K199E possibly damaging Het
Vmn1r218 T C 13: 23,320,683 (GRCm39) F10S probably damaging Het
Vmn2r89 C A 14: 51,694,897 (GRCm39) T459K probably benign Het
Vps13a T G 19: 16,655,302 (GRCm39) S1909R possibly damaging Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Vwa8 A G 14: 79,219,800 (GRCm39) H516R possibly damaging Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Zfat G C 15: 68,018,392 (GRCm39) P974R probably benign Het
Zfc3h1 T A 10: 115,259,158 (GRCm39) I1601K probably benign Het
Zfp239 A G 6: 117,848,778 (GRCm39) K172R probably benign Het
Zfp335 C T 2: 164,736,722 (GRCm39) G971D probably damaging Het
Zfp532 A T 18: 65,757,563 (GRCm39) I499F probably damaging Het
Zfp647 T C 15: 76,795,314 (GRCm39) T449A possibly damaging Het
Zfp938 C T 10: 82,061,465 (GRCm39) G385D probably damaging Het
Zfp959 T G 17: 56,204,404 (GRCm39) V147G probably damaging Het
Znfx1 A T 2: 166,892,270 (GRCm39) C649S probably damaging Het
Other mutations in Dlgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Dlgap5 APN 14 47,635,925 (GRCm39) missense probably damaging 1.00
IGL01110:Dlgap5 APN 14 47,631,783 (GRCm39) splice site probably benign
IGL02943:Dlgap5 APN 14 47,650,433 (GRCm39) critical splice donor site probably null
PIT4453001:Dlgap5 UTSW 14 47,638,979 (GRCm39) frame shift probably null
R0189:Dlgap5 UTSW 14 47,650,432 (GRCm39) splice site probably null
R0383:Dlgap5 UTSW 14 47,647,818 (GRCm39) missense probably benign 0.01
R1078:Dlgap5 UTSW 14 47,637,023 (GRCm39) missense probably damaging 1.00
R1915:Dlgap5 UTSW 14 47,645,230 (GRCm39) missense probably benign 0.00
R2051:Dlgap5 UTSW 14 47,648,941 (GRCm39) missense probably benign 0.01
R2145:Dlgap5 UTSW 14 47,633,380 (GRCm39) nonsense probably null
R2922:Dlgap5 UTSW 14 47,627,898 (GRCm39) critical splice donor site probably null
R4261:Dlgap5 UTSW 14 47,651,245 (GRCm39) missense probably damaging 1.00
R4607:Dlgap5 UTSW 14 47,650,475 (GRCm39) missense possibly damaging 0.87
R4724:Dlgap5 UTSW 14 47,638,977 (GRCm39) critical splice donor site probably null
R4898:Dlgap5 UTSW 14 47,651,276 (GRCm39) missense probably benign 0.01
R5135:Dlgap5 UTSW 14 47,637,122 (GRCm39) missense probably damaging 1.00
R5154:Dlgap5 UTSW 14 47,651,177 (GRCm39) missense probably damaging 1.00
R5650:Dlgap5 UTSW 14 47,649,196 (GRCm39) missense probably benign 0.01
R5849:Dlgap5 UTSW 14 47,626,892 (GRCm39) missense possibly damaging 0.95
R5958:Dlgap5 UTSW 14 47,651,211 (GRCm39) missense probably damaging 1.00
R6845:Dlgap5 UTSW 14 47,654,020 (GRCm39) missense possibly damaging 0.79
R7163:Dlgap5 UTSW 14 47,637,095 (GRCm39) missense probably damaging 1.00
R7529:Dlgap5 UTSW 14 47,653,876 (GRCm39) missense probably damaging 1.00
R7646:Dlgap5 UTSW 14 47,636,976 (GRCm39) critical splice donor site probably null
R8029:Dlgap5 UTSW 14 47,653,897 (GRCm39) missense probably benign 0.01
R8084:Dlgap5 UTSW 14 47,645,298 (GRCm39) missense probably benign 0.00
R9126:Dlgap5 UTSW 14 47,638,989 (GRCm39) missense probably damaging 1.00
R9166:Dlgap5 UTSW 14 47,651,206 (GRCm39) missense probably damaging 1.00
Z1177:Dlgap5 UTSW 14 47,625,520 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCGGCGACTGGTGAAATC -3'
(R):5'- TGCCAGTCGGTTTCGGAAAG -3'

Sequencing Primer
(F):5'- AGGGGATGTATGCACACCTTACC -3'
(R):5'- TTTCGGAAAGACTCGAGCACTG -3'
Posted On 2014-08-01