Incidental Mutation 'R1959:Traf7'
ID218221
Institutional Source Beutler Lab
Gene Symbol Traf7
Ensembl Gene ENSMUSG00000052752
Gene NameTNF receptor-associated factor 7
SynonymsRFWD1
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24508562-24527938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24513281 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 191 (G191C)
Ref Sequence ENSEMBL: ENSMUSP00000135874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176652] [ENSMUST00000176668] [ENSMUST00000177154] [ENSMUST00000177025] [ENSMUST00000177193] [ENSMUST00000177405] [ENSMUST00000177401]
Predicted Effect probably benign
Transcript: ENSMUST00000024958
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070777
AA Change: G152C

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752
AA Change: G152C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088464
AA Change: G190C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752
AA Change: G190C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000175698
AA Change: G20C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175732
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176237
AA Change: G151C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752
AA Change: G151C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably benign
Transcript: ENSMUST00000176353
AA Change: G152C

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752
AA Change: G152C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176633
Predicted Effect probably benign
Transcript: ENSMUST00000176652
AA Change: G190C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752
AA Change: G190C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177154
AA Change: G191C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752
AA Change: G191C

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Predicted Effect probably benign
Transcript: ENSMUST00000177502
SMART Domains Protein: ENSMUSP00000134970
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
RING 24 68 4.24e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Traf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Traf7 APN 17 24510375 unclassified probably benign
IGL01821:Traf7 APN 17 24510499 missense probably damaging 0.99
IGL02263:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02307:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02321:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02323:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02636:Traf7 APN 17 24512990 missense probably benign
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0193:Traf7 UTSW 17 24510551 missense probably benign 0.22
R1426:Traf7 UTSW 17 24511681 missense probably damaging 1.00
R1484:Traf7 UTSW 17 24511811 missense possibly damaging 0.86
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1728:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1729:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1784:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1994:Traf7 UTSW 17 24510502 missense probably damaging 0.99
R2484:Traf7 UTSW 17 24511639 missense probably damaging 1.00
R4682:Traf7 UTSW 17 24513374 missense probably damaging 1.00
R4778:Traf7 UTSW 17 24510438 unclassified probably benign
R4779:Traf7 UTSW 17 24510438 unclassified probably benign
R4781:Traf7 UTSW 17 24510438 unclassified probably benign
R5120:Traf7 UTSW 17 24518744 nonsense probably null
R6594:Traf7 UTSW 17 24509839 missense possibly damaging 0.92
R6885:Traf7 UTSW 17 24512292 missense probably benign 0.28
R7396:Traf7 UTSW 17 24509545 missense probably damaging 1.00
R7669:Traf7 UTSW 17 24513308 nonsense probably null
R7707:Traf7 UTSW 17 24510709 splice site probably null
R8087:Traf7 UTSW 17 24512064 missense possibly damaging 0.69
Z1177:Traf7 UTSW 17 24509572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTAAGACCCCACAATG -3'
(R):5'- CACCTTGGGGCCAATGAAAG -3'

Sequencing Primer
(F):5'- CACAATGTAGCCCCAGAGAGG -3'
(R):5'- AAGGCACTCGGTGGGCTTC -3'
Posted On2014-08-01