Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Abca16'

21824

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

038419-MU

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120540155 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1470 (L1470Q)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056042
AA Change: L1469Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: L1469Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120490
AA Change: L1470Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: L1470Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0024:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0525:Abca16	UTSW	7	120465810	nonsense	probably null
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6885:Abca16	UTSW	7	120520109	missense	probably benign	0.07
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7144:Abca16	UTSW	7	120433573	missense	possibly damaging	0.89
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8413:Abca16	UTSW	7	120423900	missense	probably benign	0.06
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTGTCTGTGAGAGAGCTGATCTG -3'
(R):5'- AATCACTGCCTCCATGTGCCAG -3'

Sequencing Primer
(F):5'- ATGCTGTACCACATCCCTATGAG -3'
(R):5'- CTCCATGTGCCAGAGGTAGAG -3'

Protein Function and Prediction

Abca16 encodes ABCA16, a member of the ATP-binding cassette (ABC) transporter superfamily. The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. Abca16 has been cloned rat and mouse; no human orthologue has been described. The ABCA16 has two nucleotide-binding folds and two transmembrane domains. Abca16 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis.

Posted On

2013-04-12