Incidental Mutation 'R1965:Ppid'
ID218260
Institutional Source Beutler Lab
Gene Symbol Ppid
Ensembl Gene ENSMUSG00000027804
Gene Namepeptidylprolyl isomerase D (cyclophilin D)
Synonymscyclophilin 40, 4930564J03Rik, cytoplasmic cyclophilin D, Ppidl, CYP-40
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R1965 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location79591342-79603650 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 79602299 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 308 (K308*)
Ref Sequence ENSEMBL: ENSMUSP00000029382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029382] [ENSMUST00000029386] [ENSMUST00000120992]
Predicted Effect probably null
Transcript: ENSMUST00000029382
AA Change: K308*
SMART Domains Protein: ENSMUSP00000029382
Gene: ENSMUSG00000027804
AA Change: K308*

DomainStartEndE-ValueType
Pfam:Pro_isomerase 19 183 1.5e-49 PFAM
low complexity region 208 222 N/A INTRINSIC
TPR 223 256 1.78e-1 SMART
TPR 273 306 2.59e-3 SMART
TPR 307 340 2.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029386
SMART Domains Protein: ENSMUSP00000029386
Gene: ENSMUSG00000027809

DomainStartEndE-ValueType
Pfam:Thi4 57 123 5.3e-9 PFAM
Pfam:FAD_binding_2 69 120 1.7e-7 PFAM
Pfam:Lycopene_cycl 69 125 5.7e-8 PFAM
Pfam:NAD_binding_8 72 122 9.7e-8 PFAM
Pfam:ETF_QO 511 614 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120992
SMART Domains Protein: ENSMUSP00000113888
Gene: ENSMUSG00000027809

DomainStartEndE-ValueType
Pfam:Thi4 1 63 2e-8 PFAM
Pfam:FAD_binding_2 9 59 4.7e-8 PFAM
Pfam:Pyr_redox_2 9 209 1.7e-7 PFAM
Pfam:NAD_binding_9 11 56 2.1e-7 PFAM
Pfam:NAD_binding_8 12 61 2.8e-8 PFAM
Pfam:ETF_QO 402 511 3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161876
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein has been shown to possess PPIase activity and, similar to other family members, can bind to the immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kidins220 A G 12: 24,994,906 D191G probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Phospho1 A G 11: 95,830,879 N125S probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Timm44 A G 8: 4,260,603 M383T possibly damaging Het
Tnpo2 G A 8: 85,045,317 probably null Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Ppid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Ppid APN 3 79595277 missense probably damaging 1.00
IGL01718:Ppid APN 3 79593679 missense probably damaging 1.00
IGL02347:Ppid APN 3 79595219 missense probably benign 0.00
R1109:Ppid UTSW 3 79598861 missense probably benign 0.01
R1966:Ppid UTSW 3 79602299 nonsense probably null
R1980:Ppid UTSW 3 79593618 missense probably damaging 0.96
R4706:Ppid UTSW 3 79599052 missense probably benign
R4820:Ppid UTSW 3 79595197 splice site probably null
R5969:Ppid UTSW 3 79597717 missense probably damaging 1.00
R6243:Ppid UTSW 3 79603066 missense probably benign 0.01
R7246:Ppid UTSW 3 79591433 unclassified probably benign
R7341:Ppid UTSW 3 79600297 missense probably benign
R7576:Ppid UTSW 3 79600391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCTAGAAACAGTGCTG -3'
(R):5'- GCAATTTACCTTTATCTCCTGGGG -3'

Sequencing Primer
(F):5'- ACAGCATTCTGGAGACTGC -3'
(R):5'- CTGGGGCTATCTCCTGTGC -3'
Posted On2014-08-01